Seneca virus A (SVA/HeB) full-length infectious cDNA clone as well as preparation method and application thereof

An infectious cloning and infectious technology, applied in the field of viruses, can solve the problems of complicated operation, unstable reagents, expensive and other problems, and achieve the effects of high cloning efficiency, high rescue ability and high startup efficiency.

Active Publication Date: 2021-08-27
HEBEI AGRICULTURAL UNIV.
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the RNA transfection strategy, the viral RNA is transcribed and synthesized in vitro, using the T7 or SP6 prokaryotic promoter, the viral RNA is transcribed in vitro, and then transfected into cells to start the rescue process of the virus, but this method The operation is cumbersome, unstable and the reagents are expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Seneca virus A (SVA/HeB) full-length infectious cDNA clone as well as preparation method and application thereof
  • Seneca virus A (SVA/HeB) full-length infectious cDNA clone as well as preparation method and application thereof
  • Seneca virus A (SVA/HeB) full-length infectious cDNA clone as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Construction method of infectious clone of Seneca recombinant virus

[0047] Seneca virus type A SVA / HeB (GenBank accession number: MZ375462) was isolated and preserved in this experiment. Based on the SVA genome sequence, through comparative analysis, design amplification primers that introduce rescue elements and cover the entire SVA genome:

[0048] SVA-AF: 5'-CATCATTTTGGCAAAGTGTTAAGCGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTCTTGAAATGGGGGGCTGGGCCCTCAT-3' (SEQ ID NO. 1);

[0049] SVA-AR: 5'-AGGTCCAACTAGAGTTCAAGCCTATG-3' (SEQ ID NO.2);

[0050] SVA-BF: 5'-CACAACCACAGACCCTTTCTGAA-3' (SEQ ID NO.3);

[0051] SVA-BR: 5'-TGCATTTCCATAAGAGAGAGCGCTC-3' (SEQ ID NO.4);

[0052] SVA-CF: 5'-TAGGAGCGAGAATGCTTATGACGGC-3' (SEQ ID NO.5);

[0053] SVA-CR: 5'-TACCAGATCTGAATCGCCCTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCTTTTCCCTTTTCTGTTCCGAC-3' (SEQ ID NO. 6);

[0054] In the above specific primers, the EcoR I restriction site homology...

Embodiment 2

[0059] The rescue procedure of recombinant Seneca virus is as follows:

[0060] The recombinant plasmid pOK-rSVA / HeB obtained from Example 1 was inoculated into BHK-21 cells in a 6-well plate, used for transfection when the cells grew to 80%, and 3ug The recombinant plasmid was transfected into BHK-21 cells, and the transfection reagent control and normal cell control were set up at the same time, and placed in a place containing 5% CO 2 In a 37°C incubator, observe the cell state and cell lesions, and harvest the virus when about 80% to 90% of the cells are lesions. After repeated freezing and thawing for 3 times, BHK-21 cells are inoculated again until the virus can stably produce cells. Lesions, cells appear rounded, shed, and there are a lot of floating dead cells. The resulting recombinant virus was named rSVA-HeB, and the image 3 Middle, A: picture of normal control BHK-21 cells; B: rescued recombinant virus rSVA / HeB infected BHK-21.

Embodiment 3

[0062] Culture characteristics of recombinant Seneca virus rSVA / HeB in different cells:

[0063] (1) Infect PK-15 cells with the recombinant Seneca virus rSVA / HeB strain rescued in Example 2, and cause typical cytopathy, which is similar to the wild parent strain SVA / HeB strain in culture characteristics. The lesions caused by rSVA / HeB strain on PK-15 cells are as follows: Figure 4 As shown, where A: picture of normal control PK-15 cells; B: rescued recombinant virus rSVA / HeB infected PK-15.

[0064] (2) Infect IBRS-2 cells with the recombinant Seneca virus rSVA / HeB strain rescued in Example 2, and typical cytopathic changes can be observed, which are similar to the culture characteristics of the wild parent strain SVA / HeB strain. The lesions caused by rSVA / HeB strain on IBRS-2 cells are as follows: Figure 5 Shown, where A: picture of normal control IBRS-2 cells; B: rescued recombinant virus rSVA / HeB infected IBRS-2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Seneca virus A (SVA / HeB) full-length infectious cDNA clone as well as a preparation method and application thereof, and belongs to the technical field of viruses. According to a rescue system, a CMV enhancer, a beta-actin promoter and a ribozyme sequence are introduced to the upstream of the 5' end of the Seneca virus A; and a ribozyme and terminator sequence is introduced to the downstream of the 3' end, an SVA full-length genome segment is amplified in a segmented mode through an RT-RCR method, the segment is cloned to a pOK12 vector through a homologous recombination technology, and a recombinant plasmid containing SVA / HeB full-length cDNA is constructed. The virus obtained based on infectious cDNA cloning rescue lays a foundation for deep research on biological characteristics, replication mechanism and pathogenesis of the SVA and research and development of related vaccines, and has important scientific application value.

Description

technical field [0001] The invention belongs to the technical field of viruses, and in particular relates to a type A Seneca virus SVA / HeB full-length infectious cDNA clone and a preparation method and application thereof. Background technique [0002] Senecavirus A (Senecavirus A, SVA) is a member of the Picornaviridae Senecavirus genus and is a single-stranded positive-sense RNA virus without an envelope. It has been confirmed that SVA-infected pigs can cause primary vesicular disease, causing vesicular lesions on the swine's nose and hooves, accompanied by clinical manifestations such as lameness, anorexia, lethargy and fever. It is indistinguishable from clinical symptoms caused by foot-and-mouth disease, porcine vesicular disease and vesicular stomatitis. [0003] In 2002, American scientists first discovered SVA in cell culture. After 2015, SVA outbreaks broke out in Canada, the United States, Brazil, Thailand, China and other countries. Through retrospective survei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/41C12N15/63C12N7/01C12N15/11
CPCC07K14/005C12N15/63C12N7/00C12N2770/32021C12N2770/32022C12N2770/32051
Inventor 袁万哲郭笑然赵款雷白时张武超刘小娜
Owner HEBEI AGRICULTURAL UNIV.
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap