Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High affinity monoclonal antibodies targeting glypican-1 and methods of use

A technology of monoclonal antibody and phosphatidylinositol, applied in proteoglycans, chemical instruments and methods, polypeptides containing positioning/targeting motifs, etc., can solve the elusive curative effect of solid tumors and other problems

Pending Publication Date: 2021-12-10
View PDF83 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

While immunotherapy with chimeric antigen receptor (CAR) T cells shows promise in certain hematological malignancies, their efficacy against solid tumors, including pancreatic cancer, remains elusive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High affinity monoclonal antibodies targeting glypican-1 and methods of use
  • High affinity monoclonal antibodies targeting glypican-1 and methods of use
  • High affinity monoclonal antibodies targeting glypican-1 and methods of use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0320] Example 1: Isolation and Characterization of GPC1-Specific Monoclonal Antibodies

[0321] This example describes two GPC1-specific monoclonal antibodies isolated from phage display libraries and mouse hybridomas. Mouse monoclonal antibody HM2 (SEQ ID NO:2 and SEQ ID NO:4) binds to the C-lobe of GPC1 near the cell surface, camel single domain antibody D4 (SEQ ID NO:6) recognizes the GPC1 protein core conformational epitope.

[0322] After three rounds of panning, antibody D4 ( Figure 1A ). Monoclonal phage ELISA analysis of D4 demonstrated that D4 specifically bound human and mouse GPC1, but did not exhibit any significant binding to human GPC2, GPC3, GPC5, or GPC6 ( Figure 1B ). Binding of D4 to GPC1-expressing tumor cells was assessed by flow cytometry. D4 exhibited significant binding to GPC1-overexpressing 2B9 KLM pancreatic cancer cells and GPC1-overexpressing H8 epidermoid cancer cells, but not to GPC1-negative A431 cells ( figure 2 ). use Kinetic analy...

Embodiment 2

[0329] Example 2: Immunotoxins based on D4 and HM2 antibodies

[0330] This example describes the generation and testing of immunotoxins consisting of D4 or HM2 antibodies and a truncated form of Pseudomonas exotoxin A lacking domain II (referred to herein as "LR").

[0331] immunotoxin sequence

[0332] Four different immunotoxins were generated: D4-LR, HM2-LR, D4-AAA-D4-LR and D4-GGS-D4-LR. The latter two immunotoxins consist of D4 dimers separated by a three amino acid linker (AAA or GGS). The nucleotide and amino acid sequences of the four immunotoxins are provided below. The LR coding sequence (for nucleotide sequences) and the LR portion of the amino acid sequence are underlined.

[0333] D4-LR nucleotide sequence (SEQ ID NO: 14)

[0334] ATGCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCCGGGGGGTCTCTGAGACTCTCCTGTGTAGCCTCTGGATACAGCTACAGTATTGGTTACATGGCCTGGTTCCGCCAGGCCCCAGGAAAGGAGCGCGCGTGGGTCGCGTCTCGATATACTGGTGACGGTGGCGCAGTCTTTGACGACGCCGTGAAGGGCCGATTCACCACCTCCCAAGAGAGTGCCGGGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Monoclonal antibodies that specifically bind glypican-1 (GPC1) are described. Chimeric antigen receptor (CAR) T cells, immunotoxins and other antibody conjugates based on the GPC1-specific antibodies are also described. The disclosed CAR T cells, immunotoxins, GPC1-specific antibodies and conjugates thereof can be used, for example, in the diagnosis or treatment of GPC1-positive pancreatic cancer and other cancers.

Description

[0001] Cross References to Related Applications [0002] This application claims the benefit of U.S. Provisional Application No. 62 / 795,415, filed January 22, 2019, which is hereby incorporated by reference in its entirety. technical field [0003] The present disclosure relates to a monoclonal antibody specifically binding to glypican-1 (GPC1) with high affinity and uses of the monoclonal antibody, for example, for diagnosing and treating tumors expressing GPC1. [0004] Government Support Recognition [0005] This invention was made with government support under Grant No. Z01 BC010891 awarded by the National Institutes of Health. The government has certain rights in this invention. Background technique [0006] Glypican is a cell surface heparan sulfate proteoglycan (HSPG) with a membrane-associated protein core anchored to the plasma membrane by glycosylphosphatidylinositol (GPI) bonds. Post-translationally, HSPG is modified by the covalent linkage of two or more li...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/30C07K14/435A61K47/68
CPCC07K16/303C07K2317/22C07K2317/569C07K2317/30C07K2319/03C07K2319/33C07K2317/92C07K2317/73A61K2039/505A61K2039/852C07K2317/622C07K14/4725A61K47/6929A61K47/6829A61P35/04
Inventor 何苗壮潘佳佳李楠
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com