Photocleavable protein mutants with high photocleavage efficiency and applications thereof
A protein mutant and light cutting technology, applied in the field of genetic engineering, can solve the problems of long UV light irradiation time and low cutting efficiency, and achieve the effect of improving light cutting efficiency, purification efficiency and high light cutting efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] This example is used to illustrate the obtaining of the photocleavable protein provided by the present invention.
[0063] The pBAD-phoCl plasmid used in this example is a pBAD plasmid as a carrier, and is inserted into the expression system of the phoCl expression gene. The preparation method can refer to Zhang Fan, 2012, Preparation of recombinant Bifidobacterium longum engineering bacteria expressing interferon-α2b, China Journal of Pathogen Biology, 007(003):190-191,194.
[0064] In the present example, primers F1 (ATGGTGATCCCTGACTACTTCAAGCAG, SEQ ID NO: 11) and R1 (TTACCGTGGGTACTTGGTGAACACG, SEQ ID NO: 12) were both synthesized by Entrust Ruibo Xingke Biotechnology Co., Ltd.
[0065] (1) Construction of a library of photocleavable protein mutants
[0066] Using the pBAD-phoCl plasmid as the template and primers F1 and R1 as the forward and reverse primers, the directional evolution of error-prone PCR was performed according to the reaction system in Table 1 and the ...
Embodiment 2
[0097] This example is used to illustrate the expression and purification of the fusion protein provided by the present invention.
[0098] (1) Detection of fusion protein activity
[0099] Based on molecular biology operations, the mutant proteins 1 and 2 screened in test (5) in Example 1 were fused and expressed with the antimicrobial peptide Hisatatin 1.
[0100] The original protein phoCl, mutant 1 and mutant 2 linked with a purification tag (polyhistidine tag, the amino acid sequence is shown in SEQ ID NO: 4) were respectively fused and expressed with the antimicrobial peptide Hisstatin1 (commissioned by General Biotechnology). , after purification by the purification tag, the purified protein was cleaved at 385nm wavelength for 0min, 1min, 5min, 10min, 30min, 60min, 90min and 120min, and the cleavage was detected by electrophoresis.
[0101] Figure 12-14 The antimicrobial peptide expressed in fusion with the original protein (phoCl-Histatin1), the antimicrobial peptid...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com