Light cleavable protein mutant with high light cleavage efficiency and application thereof

A technology of protein mutants and mutants, which is applied in the field of genetic engineering, can solve the problems of low cutting efficiency and long UV light irradiation time, and achieve the effects of improved photocutting efficiency, high-throughput protein purification, and high purification efficiency

Active Publication Date: 2022-04-12
COFCO NUTRITION & HEALTH RES INST
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a photocleavable protein mutant with high photocleavage efficiency and its application in order to overcome the problems of long UV light irradiation time and low cutting efficiency when the photocleavable protein is photocleaved in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Light cleavable protein mutant with high light cleavage efficiency and application thereof
  • Light cleavable protein mutant with high light cleavage efficiency and application thereof
  • Light cleavable protein mutant with high light cleavage efficiency and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This example is used to illustrate the obtaining of the photocleavable protein provided by the present invention.

[0063] The pBAD-phoCl plasmid used in this example is an expression system in which the pBAD plasmid is used as a carrier to insert the phoCl expression gene. The preparation method can refer to Zhang Fan, 2012, Preparation of recombinant Bifidobacterium longum engineering bacteria expressing interferon-α2b, China Journal of Pathogen Biology, 007(003):190-191,194.

[0064] In this example, primers F1 (ATGGTGATCCCTGACTACTTCAAGCAG, SEQ ID NO: 11) and R1 (TTACCGTGGGTACTTGGTGAACACG, SEQ ID NO: 12) were synthesized by Ruibo Xingke Biotechnology Co., Ltd.

[0065] (1) Construction of photocleavable protein mutant library

[0066] Using the pBAD-phoCl plasmid as a template, using primers F1 and R1 as forward and reverse primers, respectively, the directed evolution of error-prone PCR was carried out according to the reaction system in Table 1 and the error-prone P...

Embodiment 2

[0097] This example is used to illustrate the expression and purification of the fusion protein provided by the present invention.

[0098] (1) Detection of fusion protein activity

[0099] Based on molecular biology operations, the mutant proteins 1 and 2 screened in the test (5) in Example 1 were fused with the antimicrobial peptide Hisatatin 1 for expression.

[0100] The original protein phoCl, mutant 1 and mutant 2 linked with a purification tag (polyhistidine tag, amino acid sequence shown in SEQ ID NO: 4) were fused with the antimicrobial peptide Hisatin1 (synthesized by General Biotech) , after purification using the purification tag, the purified protein was cleaved at a wavelength of 385nm for 0min, 1min, 5min, 10min, 30min, 60min, 90min and 120min, and the cleavage was detected by electrophoresis.

[0101] Figure 12-14 The antibacterial peptide fused with the original protein (phoCl-Histatin1), the antimicrobial peptide fused with mutant 1 (mutant 1-Histatin1) an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Minimum inhibitory concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of gene engineering, and discloses a photo-cleavable protein mutant with high photo-cleavage efficiency and application of the photo-cleavable protein mutant. The photo-cleavable protein mutant is a mutant of a photo-cleavable protein phoCl, the amino acid sequence of the photo-cleavable protein phoCl is as shown in SEQ ID NO: 1, and the photo-cleavable protein mutant is mutated in at least one of 8-232 amino acid residues of the photo-cleavable protein phoCl. The light-cleavable protein mutant provided by the invention can obtain relatively high cleavage efficiency within a relatively short UV illumination time. The light cleavable protein mutant provided by the invention can be subjected to fusion expression with different target proteins, the purification efficiency of the obtained fusion proteins is high, and efficient recovery of the target proteins is realized.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a photocleavable protein mutant with high photocleavage efficiency and its application. Background technique [0002] With the development of biotechnology, relatively mature high-efficiency prokaryotic and eukaryotic protein expression systems have been developed, and the use of microbial expression systems for target protein production has gradually formed a large-scale industrial production system. However, the expression of the target protein is often accompanied by the expression of other proteins in the expression system, so that the obtained expression products are often a mixture of the target protein and other proteins. Therefore, protein purification has become a key link in genetic engineering and protein engineering. The efficiency of protein purification determines the yield of recombinant protein, and protein purification technology also determines the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/00C07K19/00
Inventor周娜娜安泰王小艳王磊张媛赵国淼王靖李凡杨凯王满意牛兴和郝小明
OwnerCOFCO NUTRITION & HEALTH RES INST