Probiotics for relieving metabolic syndrome as well as metabolite formula and application thereof

A technology for metabolic syndrome and metabolites, applied in the field of probiotics and their metabolites (postbiotics) formulations, can solve the problems of difficulty in persistence, rapid rebound, and long cycle

Pending Publication Date: 2022-05-13
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, diet and exercise intervention are effective means of prevention and early intervention for the treatment of metabolic syndrome, but most people are difficult to adhere to this means, and there are problems of long cycle and rapid rebound
Taking drugs to reduce appetite and clinical surgery to lose weight have strong side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probiotics for relieving metabolic syndrome as well as metabolite formula and application thereof
  • Probiotics for relieving metabolic syndrome as well as metabolite formula and application thereof
  • Probiotics for relieving metabolic syndrome as well as metabolite formula and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Experimental method

[0036] 1. Probiotic strain category and patent preservation number

[0037] The present invention obtained 5 strains of probiotics through screening and isolation, through 16S sequencing (16S full-length amplification primer, 16S_Forw: AGAGTTTGATCCTGGCTCAG, 16S_Rev: GGTTACCTTGTTACGACTT), whole genome sequencing circular functional map (extracting strain fermentation sludge nucleic acid, building a library Next-generation sequencing was carried out, and the sequencing platform was Ilumina Hiseq X10) and evolutionary tree construction was carried out to obtain Lactobacillus reuteri ( Lactobacillus reuteri )PLBK ® 1. Lactobacillus reuteri ( Lactobacillus reuteri )PLBK ® 2. Lactobacillus gasseri ( Lactobacillus gasseri )PLBK ® 3. Lactobacillus acidophilus ( Lactobacillus acidophilus )PLBK ® 4. Bifidobacterium lactis ( Bifdobacterium lactis )PLBK ® 5 genome information, the specific information is as follows:

[0038] Lactobacillus reute...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses probiotics for relieving metabolic syndrome and a metabolite formula and application thereof. The probiotic formula for relieving the metabolic syndrome is characterized in that the probiotic formula is one or more of lactobacillus reuteri PLBK1, lactobacillus reuteri PLBK2, lactobacillus gasseri PLBK3, lactobacillus acidophilus PLBK4 and bifidobacterium lactis PLBK5, or a fermentation culture of the lactobacillus reuteri PLBK1, the lactobacillus reuteri PLBK2, the lactobacillus gasseri PLBK3, the lactobacillus acidophilus PLBK4 and the bifidobacterium lactis PLBK5, or a fermentation culture of the lactobacillus reuteri PLBK1, the lactobacillus reuteri PLBK2, the lactobacillus gasseri PLBK3, the lactobacillus acidophilus PLBK4 and the bifidobacterium lactis PLBK5, or a metabolite of The invention particularly relates to core components of five probiotics which are independently separated, identified and preserved in patents and fermentation metabolites (postbiotics) of the probiotics and application of the probiotics in relieving the metabolic syndrome, in particular to an application mechanism of promoting white lipolysis, and by applying the probiotics, fat accumulation can be reduced, lipolysis can be promoted, insulin sensitivity can be improved, and the metabolic syndrome can be relieved. And the pharmaceutical composition is expected to be applied to prevention and treatment of metabolic syndrome.

Description

technical field [0001] The invention belongs to the field of microorganisms, and in particular relates to formulas and applications of probiotics and their metabolites (postbiotics) for alleviating metabolic syndrome. Background technique [0002] The occurrence and development of metabolic syndrome, such as obesity, diabetes, and (non-)alcoholic fatty liver, seriously threaten human health and bring heavy economic burden and medical pressure to the country and families. At present, diet and exercise intervention are effective means of prevention and early intervention for the treatment of metabolic syndrome, but it is difficult for most people to adhere to this means, and there are problems of long cycle and rapid rebound. Taking drugs to reduce appetite and clinical surgery to lose weight have strong side effects. Studies have found that the occurrence and development of metabolic syndrome are often accompanied by intestinal flora disorders and systemic glucose and lipid ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A61K35/747A61P1/16A61P3/04A61P5/50A23L33/135C12R1/225C12R1/23C12R1/01A61K35/745
CPCC12N1/20A61K35/747A61K35/745A61P3/04A61P5/50A61P1/16A23L33/135A23V2002/00A23V2400/145A23V2400/173A23V2400/113A23V2400/531A61K2300/00A23V2200/30A61P3/00C12N1/205C12R2001/225C12R2001/23C12R2001/01A61K2035/115
Inventor 谢黎炜田也刘秉东韩木兰
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products