Probiotics for relieving metabolic syndrome as well as metabolite formula and application thereof
A technology for metabolic syndrome and metabolites, applied in the field of probiotics and their metabolites (postbiotics) formulations, can solve the problems of difficulty in persistence, rapid rebound, and long cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] 1. Experimental method
[0036] 1. Probiotic strain category and patent preservation number
[0037] The present invention obtained 5 strains of probiotics through screening and isolation, through 16S sequencing (16S full-length amplification primer, 16S_Forw: AGAGTTTGATCCTGGCTCAG, 16S_Rev: GGTTACCTTGTTACGACTT), whole genome sequencing circular functional map (extracting strain fermentation sludge nucleic acid, building a library Next-generation sequencing was carried out, and the sequencing platform was Ilumina Hiseq X10) and evolutionary tree construction was carried out to obtain Lactobacillus reuteri ( Lactobacillus reuteri )PLBK ® 1. Lactobacillus reuteri ( Lactobacillus reuteri )PLBK ® 2. Lactobacillus gasseri ( Lactobacillus gasseri )PLBK ® 3. Lactobacillus acidophilus ( Lactobacillus acidophilus )PLBK ® 4. Bifidobacterium lactis ( Bifdobacterium lactis )PLBK ® 5 genome information, the specific information is as follows:
[0038] Lactobacillus reute...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap