Method for constructing and applying ep400 gene knockout zebrafish heart failure model

A gene knockout and heart failure technology, applied in the field of construction of ep400 gene knockout zebrafish heart failure model

Active Publication Date: 2022-05-13
HUNAN NORMAL UNIVERSITY
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] ep400 (E1A binding protein p400) gene is located on chromosome 8 of zebrafish, including 52 exons, and the full-length cDNA is 9126bp. EP400 is a SWR1-like ATP-dependent chromatin remodeling protein, and Tip60 constitutes histone acetylation The Tip60 / p400 complex is involved in the transcriptional regulation of a variety of genes, and at the same time plays a role in inhibiting apoptosis or aging in cell processes, but so far, there is no known ep400 Reports related to the occurrence and development of heart disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing and applying ep400 gene knockout zebrafish heart failure model
  • Method for constructing and applying ep400 gene knockout zebrafish heart failure model
  • Method for constructing and applying ep400 gene knockout zebrafish heart failure model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1) Design CRISPR / Cas9 gene knockout target sites and detection primers respectively

[0036] Query Zebrafish at the National Center for Biotechnology Information (NCBI) ep400 Genomic DNA sequence of the gene, designed on the website The ZiFiT Targeter (http: / / zifit.partners.org / ZiFiT / ) according to the principle of CRISPR / Cas9 knockout ep400 The targeting site of the gene (one targeting site is selected in the region of exon 11 and exon 12 each);

[0037] Specific target site PCR primers are as follows:

[0038] F1 (forward primer)

[0039] tgtaatacgactcactataggacctcgctgtcagatgtgggttttagagctagaaatagc

[0040] F2 (forward primer)

[0041] tgtaatacgactcactataggtacaatagaagagcagggttttagagctagaaatagc

[0042] R (reverse primer): aagcaccgactcggtgccact

[0043] PCR detection primers:

[0044] F (5'-gcttgcctctggaaattctgct-3')

[0045] R (5'-tcgaagccctcagcgtaagcc-3')

[0046] 2) In vitro synthesis of specific gRNA

[0047] a, with BsaI restriction enzyme p 42250 lineari...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of gene knockout, and particularly discloses a construction method and an application method of an ep400 gene knockout zebrafish heart failure model. A CRISPR / Cas9 gene editing technology is utilized, two unique targeting sites are designed at the 11th exon and the 12th exon, 162bp fragments (wherein the exon is 76bp, and the intron is 86bp) between the two target sites are knocked out, and an ep400 gene knockout homozygote is bred, so that the zebrafish heart failure zebrafish model is constructed; in addition, the invention also discloses a mutant phenotype of the ep400 gene knockout zebrafish. On one hand, the invention can be used for exploring the biological function of the ep400 gene in vivo, on the other hand, the relevance between the ep400 gene and the heart failure is revealed for the first time, an ideal animal model is provided for researching the mechanism of exploring the heart failure caused by the ep400 in the future, and the invention also has important significance for screening clinical heart failure treatment drugs.

Description

technical field [0001] The present invention relates to the field of gene knockout, especially discloses ep400 Construction and application of gene knockout zebrafish heart failure model. Background technique [0002] ep400 (E1A binding protein p400) gene is located on chromosome 8 of zebrafish, including 52 exons, and the full-length cDNA is 9126bp. EP400 is a SWR1-like ATP-dependent chromatin remodeling protein, and Tip60 constitutes histone acetylation The Tip60 / p400 complex is involved in the transcriptional regulation of a variety of genes, and at the same time plays a role in inhibiting apoptosis or aging in cell processes, but so far, there is no known ep400 Reports related to the occurrence and development of heart disease. [0003] The genes and signaling pathways in the development of zebrafish and human hearts are highly conserved; the similarities between zebrafish and mammalian hearts, small size, easy feeding, fast development, strong reproductive ability, i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/113C12N9/22C12N15/12A01K67/027
CPCC12N15/8509C12N15/113C12N9/22C07K14/461A01K67/0278C12N2310/20C12N2800/106A01K2217/077A01K2227/40A01K2267/0375
Inventor 邓云欧阳诗黄东花陈佳乐易巧荣覃武明曹秋香
Owner HUNAN NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap