Application of CIRBP gene or protein coded by CIRBP gene in myocardial injury treatment
A myocardial injury, protein technology, applied in the field of medicine and biology, to achieve the effect of rescuing apoptosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1: Study on the expression of CIRBP in cardiomyocytes induced by chemotherapeutic drugs
[0046] Western Blot was used to detect chemotherapy drugs (DOX, cisplatin and 5-FU) induced human immortalized ventricular myocytes AC16, human immortalized ventricular myocytes T0519 (purchased from Abm, Canada), human pluripotent stem cell-derived cardiomyocytes (hiPSC- CIRBP expression levels in CMs), neonatal rat ventricular myocytes (NRVMs) and normal cells.
[0047] 1. Cell selection and culture:
[0048] The cells used in the experiment include human immortalized ventricular myocytes AC16, human immortalized ventricular myocytes T0519 (purchased from Abm, Canada), human pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), and neonatal rat ventricular myocytes (NRVMs). .
[0049] The cells were cultured as follows: cells were used in medium containing 10% fetal bovine serum [AC16 and NRVMs using DMEM high-glucose medium, T0519 using Prigrow I medium (abm, TM001...
Embodiment 2
[0070] Example 2: Study on the expression of CIRBP in mouse cardiomyocytes induced by chemotherapy drugs
[0071] Western Blot was used to detect the expression level of CIRBP in the cardiomyocytes of the mouse chemotherapy model induced by chemotherapy drugs (DOX, cisplatin and 5-FU).
[0072] 1. Mouse selection:
[0073] 6-7-week-old C57BL / 6 male mice (purchased from the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences, Beijing, China) were selected and received adaptive feeding for 1 week before the start of the study. All mice were housed in individual ventilated cages under specific (temperature: 20-25°C; humidity: 50±5%) barrier conditions.
[0074] 2. Construction of mouse chemotherapy model:
[0075] (1) Construction of mouse chemotherapy model:
[0076] The mice were injected with DOX (injection dose of 5 mg / kg) into the tail vein, once a week, and injected continuously for four weeks to establish a mouse chemotherapy model. Follow-up expe...
Embodiment 3
[0089] Example 3: Study on the effect of CIRBP gene knockout and gene knockout on myocardium
[0090] 1. Cell selection:
[0091] The cells selected in the experiment include human immortalized ventricular myocytes AC16 and neonatal rat ventricular myocytes (NRVMs).
[0092] 2. siRNA design:
[0093] The siRNA sequence for the CIRBP gene is:
[0094] The siRNA sense sequence of human CIRBP is: GGCUCCAGAGACUACUAUA,
[0095] The siRNA antisense sequence of human CIRBP is: UAUAGUAGUCUCUGGAGCCTT;
[0096] The siRNA sense sequence of rat CIRBP is: AUUUUCAAAGGUGACAAACCC,
[0097] The siRNA antisense sequence of rat CIRBP is: GUUUGUCACCUUUGAAAAUAU;
[0098] Negative control siRNA (denoted as NC) sense sequence: UUGUUCGAACGUGUCACGUUU,
[0099] Negative control siRNA (denoted as NC) antisense sequence: AACAAGCUUGCACAGUGCAAA.
[0100] 3. Experimental method:
[0101] (1) The specific experimental process of gene knockout and the specific experimental process of DOX medication af...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



