Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of CIRBP gene or protein coded by CIRBP gene in myocardial injury treatment

A myocardial injury, protein technology, applied in the field of medicine and biology, to achieve the effect of rescuing apoptosis

Active Publication Date: 2022-06-07
唐颢 +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether CIRBP is involved in the regulation of cardiomyocyte apoptosis and myocardial injury protection during tumor chemotherapy remains unknown.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CIRBP gene or protein coded by CIRBP gene in myocardial injury treatment
  • Application of CIRBP gene or protein coded by CIRBP gene in myocardial injury treatment
  • Application of CIRBP gene or protein coded by CIRBP gene in myocardial injury treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Study on the expression of CIRBP in cardiomyocytes induced by chemotherapeutic drugs

[0046] Western Blot was used to detect chemotherapy drugs (DOX, cisplatin and 5-FU) induced human immortalized ventricular myocytes AC16, human immortalized ventricular myocytes T0519 (purchased from Abm, Canada), human pluripotent stem cell-derived cardiomyocytes (hiPSC- CIRBP expression levels in CMs), neonatal rat ventricular myocytes (NRVMs) and normal cells.

[0047] 1. Cell selection and culture:

[0048] The cells used in the experiment include human immortalized ventricular myocytes AC16, human immortalized ventricular myocytes T0519 (purchased from Abm, Canada), human pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), and neonatal rat ventricular myocytes (NRVMs). .

[0049] The cells were cultured as follows: cells were used in medium containing 10% fetal bovine serum [AC16 and NRVMs using DMEM high-glucose medium, T0519 using Prigrow I medium (abm, TM001...

Embodiment 2

[0070] Example 2: Study on the expression of CIRBP in mouse cardiomyocytes induced by chemotherapy drugs

[0071] Western Blot was used to detect the expression level of CIRBP in the cardiomyocytes of the mouse chemotherapy model induced by chemotherapy drugs (DOX, cisplatin and 5-FU).

[0072] 1. Mouse selection:

[0073] 6-7-week-old C57BL / 6 male mice (purchased from the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences, Beijing, China) were selected and received adaptive feeding for 1 week before the start of the study. All mice were housed in individual ventilated cages under specific (temperature: 20-25°C; humidity: 50±5%) barrier conditions.

[0074] 2. Construction of mouse chemotherapy model:

[0075] (1) Construction of mouse chemotherapy model:

[0076] The mice were injected with DOX (injection dose of 5 mg / kg) into the tail vein, once a week, and injected continuously for four weeks to establish a mouse chemotherapy model. Follow-up expe...

Embodiment 3

[0089] Example 3: Study on the effect of CIRBP gene knockout and gene knockout on myocardium

[0090] 1. Cell selection:

[0091] The cells selected in the experiment include human immortalized ventricular myocytes AC16 and neonatal rat ventricular myocytes (NRVMs).

[0092] 2. siRNA design:

[0093] The siRNA sequence for the CIRBP gene is:

[0094] The siRNA sense sequence of human CIRBP is: GGCUCCAGAGACUACUAUA,

[0095] The siRNA antisense sequence of human CIRBP is: UAUAGUAGUCUCUGGAGCCTT;

[0096] The siRNA sense sequence of rat CIRBP is: AUUUUCAAAGGUGACAAACCC,

[0097] The siRNA antisense sequence of rat CIRBP is: GUUUGUCACCUUUGAAAAUAU;

[0098] Negative control siRNA (denoted as NC) sense sequence: UUGUUCGAACGUGUCACGUUU,

[0099] Negative control siRNA (denoted as NC) antisense sequence: AACAAGCUUGCACAGUGCAAA.

[0100] 3. Experimental method:

[0101] (1) The specific experimental process of gene knockout and the specific experimental process of DOX medication af...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of medical biology, and relates to application of a CIRBP gene or a protein coded by the CIRBP gene in myocardial injury treatment. The invention provides a medicine for treating myocardial cell injury induced by an anti-tumor medicine. The medicine contains an accelerant for CIRBP gene expression or CIRBP protein; the accelerant is a substance for improving the expression quantity of the CIRBP gene, and further, the accelerant is a recombinant vector containing a coding CIRBP protein or a recombinant cell containing the coding CIRBP protein. The relation between the CIRBP and the anti-tumor drug induced myocardial injury is determined, so that the CIRBP can be used as a drug, a drug target or a target gene in gene therapy, and is applied to prevention, alleviation or / and treatment of the anti-tumor drug induced myocardial injury.

Description

technical field [0001] The invention belongs to the field of medical biotechnology, and particularly relates to the application of CIRBP gene or the protein encoded by it in the treatment of myocardial injury. Background technique [0002] The development of tumor treatment technology has greatly improved the quality of life of patients and increased their survival rate. However, frequent cardiovascular events have become the primary reason for restricting the effect of tumor treatment and threatening the survival time of patients. Cardiotoxicity of chemotherapy drugs is the main cause of adverse cardiovascular events. Traditional drugs (such as doxorubicin, fluorouracil and other broad-spectrum chemotherapy drugs) and targeted drugs (such as trastuzumab) can cause different degrees of myocardial damage, induce myocardial infarction, arrhythmia, cardiomyopathy, and even cardiogenic Sudden death and other high-risk cardiac diseases. A large amount of evidence shows that ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68C12Q1/6851C12Q1/6883A61K45/00A61P9/00
CPCG01N33/6893C12Q1/6851C12Q1/6883A61K45/00A61P9/00G01N2333/47G01N2800/325C12Q2600/158C12Q2600/136C12Q2563/107C12Q2561/113C12Q2531/113
Inventor 唐颢邢珺月刘词航刘琳程晓雷简冬冬李臻李然王世星
Owner 唐颢
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com