Method and composition for altering a t cell mediated pathology

A composition and cell technology, applied in the field of immunology and immunotherapy, can solve the problems of low production level and difficult production of TCR molecules

Inactive Publication Date: 2006-09-06
FAVRILLE
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as mentioned above, the production of these TCR molecules is difficult and the production levels are low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and composition for altering a t cell mediated pathology
  • Method and composition for altering a t cell mediated pathology
  • Method and composition for altering a t cell mediated pathology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0159] Example 1. Tissue processing for T-cell lymphoma idiotype (Id) identification and cloning:

[0160] Tumor samples obtained from peripheral lymph nodes were biopsied under sterile conditions according to clinically prescribed methods, and the samples were used to produce patient idiotype-specific recombinant V α and V β - Ig chimeric protein. Store the remaining lymph node biopsy material in a tissue cell bank in liquid nitrogen for future use.

[0161]Cell Isolation: Single cell suspensions of patient lymph node biopsy samples were obtained by forcing the patient biopsy lymphoma tissue through a disposable 0.38 mm steel mesh and simultaneously immersed in sterile PBS. Dispersed cells were washed twice with PBS, then resuspended and counted. A 10% ratio of the cells was processed for total RNA extraction and the remaining cells were stored in liquid nitrogen after resuspension in RPMI 1640 tissue culture medium containing 30% fetal bovine serum and 10% DMSO. All clin...

Embodiment 2

[0169] Example 2. Baculovirus expression vector pTRABacV containing immunoglobulin heavy chain and light chain constant regions α HC γ1 and pTRABacV β HC γ1 build

[0170] Cloning of the secretion signal sequence into p2Bac: pTRABacHuLC κ HC γ1 and pTRABacHuLC λ HC γ1 The base vector for the construct was p2Bac (Figure 2, SEQ ID NO: 5, Invitrogen, Carlsbad, CA). The two secretion signal sequences were cloned into the basic vector to construct the first intermediate baculovirus expression vector p2BacM. In summary, vector p2Bac was first modified with complementary oligonucleotides encoding the amino-terminal domain of the honeybee melittin secretion signal sequence positioned to place under the transcriptional control of the baculovirus AcNPV P10 promoter. For cloning of the melittin sequence, 2 μg of p2Bac was digested with Not I and Spe I at 37°C for 4 hours. The linear vector was purified with Qiaex II resin (Qiagen, Chatsworth, CA) after electrophoresis through a ...

Embodiment 3

[0183] Example 3. The patient-derived idiotype V α and / or V β Stranded genes are inserted into expression vectors

[0184] Separate V as described above α and / or V β After the tumor-derived sequence of the chain, an oligonucleotide primer containing the terminal 40 nucleotides of the melittin leader peptide (for V β chain cloning) (SEQ ID NO: 8-ACTAGTTTTT ATGGTCGTGT ACATTTTCTTACATCTATGCG), an oligonucleotide primer containing the terminal 31 nucleotides of the alkaline phosphatase leader peptide (for V α chain clone) (SEQ ID NO: 9-AGGCCTGAGGCTACAGCTCT CCCTGGGC) and containing the corresponding V α or V β Oligonucleotide primers for the first 20 nucleotides of the gene. A reverse oligonucleotide primer complementary to base pairs 4-36 of CA (CA / IgK; SEQ ID NO: 15) and a reverse oligonucleotide primer complementary to base pairs 6-35 of CB from the α or β chain constant region were used. To the oligonucleotide primer (CB / IgG 1 : SEQ ID NO: 14). identified as previously ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a method for altering a T cell mediated pathology in a patient. This method comprises administering a composition comprising at least one and / or two chimeric proteins. Each chimeric protein comprises at least a portion of either the Valpha or Vbeta region of a TCR from particular T cells from a patient having a T cell mediated pathology, and an immunoglobulin constant region. The genes encoding Valpha and / or Vbeta regions and the genes encoding immunoglobulin constant regions are isolated and inserted into an expression vector. The chimeric proteins are produced by introducing the expression vectors into insect cell lines. The chimeric proteins are purified using antibody affinity columns, and then chemically conjugated to an immunogenic carrier, keyhole-limpet hemocyanin (KLH). Since the conjugates comprises chimeric proteins made specifically from particular T cells from a patient having T cell mediated pathology, when it is administered to such a patient, with or without a cytokine, such as granulocyte-macrophage-CSF, or a chemokine, it can induce immune responses to alter such a T cell mediated pathology.

Description

[0001] related application [0002] This application claims U.S. Provisional Application No. 60 / 224,723, entitled "Method for producing an Idiotypic Vaccine," entitled "Expression Vectors for Production of Recombinant Immunoglobulin." Vector)" and U.S. Provisional Application No. 60 / 266,133 entitled "Method and Composition for Altering a T Cell Mediated Pathology" number priority. field of invention [0003] The present invention relates generally to the fields of immunology and immunotherapy. More specifically, the present invention relates to methods and compositions for altering T cell mediated pathologies such as T cell malignancies and / or autoimmune diseases. Background of the invention [0004] The present invention relates generally to the fields of immunology and immunotherapy. More specifically, the present invention relates to methods and compositions for altering T cell mediated patholog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/395A61K39/385A61P37/00A61P35/00C12N15/866C12N5/10C07K16/00G01N33/68
InventorD·P·戈德R·J·肖佩斯
OwnerFAVRILLE