Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleotide sequence encoding defence response gene of sea island cotton, plant expression vector and plant cell containing the sequence

The technology of plant expression vector and nucleotide sequence is applied to the nucleotide sequence encoding the defense response gene of sea island cotton, the plant expression vector containing the sequence and the field of plant cells, which can solve the limitations of conventional breeding, lack of antigen, Problems such as rapid mutation of pathogenic bacteria

Inactive Publication Date: 2005-04-27
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the rapid mutation of pathogenic bacteria and the lack of available antigens, the role of conventional breeding has been greatly limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleotide sequence encoding defence response gene of sea island cotton, plant expression vector and plant cell containing the sequence
  • Nucleotide sequence encoding defence response gene of sea island cotton, plant expression vector and plant cell containing the sequence
  • Nucleotide sequence encoding defence response gene of sea island cotton, plant expression vector and plant cell containing the sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Embodiment 1: the preparation of the structural gene of coding GbRAR1, GbSGT1, GbRac1 protein

[0072] Total RNA was extracted from the leaves of Cotton 7124 (National Germplasm Bank of Chinese Academy of Agricultural Sciences, #00070074) treated with Verticillium dahliae, and the first strand of cDNA was synthesized with 5 μg of total RNA and oligo d(T) primer as substrate For specific operations, refer to the kit instructions (GIBCOBRL Company, catalog number #11146-024).

[0073] Cloning of 1.1GbRar1 gene

[0074] 1.1.1 Cloning of the 5' end of the GbRar1 gene

[0075] According to the cotton EST clone (GenBank accession number: BQ403789 , BF276058 , BG443488 , BG446854 , BQ412690 ) and upland cotton EST clones (GenBank accession number: AW187113 , AW187078 ), design primers:

[0076] pRR: 5'ATGGCGGAGCAAGCTGTT 3'

[0077] pFR: 5'ATTCCTCCTCATGCTTATGAC 3'

[0078] Using the first strand of sea island cotton cDNA as a template, PCR amplification was ca...

Embodiment 2

[0118] Embodiment 2: the construction of GbRar1, GbSgt1, GbRac1 gene plant expression vector

[0119] 2.1 Construction of target gene expression cassette

[0120] As mentioned above, the gene expression cassette constructed in this example includes the following gene expression regulatory elements: 35S promoter at the 5' end, doubled enhancer, Ω sequence and Kozak sequence, concatenated termination sequence and cutting sequence at the 3' end , NOS terminator. DNA fragment P5 including 35S promoter, doubled enhancer, Ω sequence and Kozak sequence and DNA fragment T3 including concatenated termination sequence, cleavage sequence and NOS terminator were synthesized by artificial synthesis methods well known in the art. For the convenience of construction, HindIII and PstI restriction sites were introduced at the 5' and 3' ends of P5, respectively, and PstI and EcoRI restriction sites were introduced at the 5' and 3' ends of T3, respectively. Digest P5 with HindIII / PstI, treat T...

Embodiment 3

[0128] Example 3: Introduction and Identification of GbRar1, GbSgt1, GbRac1 Gene Plant Expression Vectors in Model Plant Nicotiana tabacum

[0129] 3.1 Preparation of LBA4404 Competent Cells

[0130] Pick a single colony of LBA4404 (CLONTECH company, catalog number #6027-1) and inoculate it in 5ml YEB (containing streptomycin 100μg / ml, sucrose 5g+ peptone 5g+ beef extract 5g+ yeast extract 1g+MgSO4.7H2O 0.049g / L , pH7.2), 28°C, 250rpm for overnight cultivation. Take 2ml colony and add it to 50ml YEB medium, continue to cultivate to OD 600 The value is about 0.6. Transfer the bacterial solution to a sterile centrifuge tube, ice bath for 30 minutes, centrifuge at 5000rpm for 5 minutes, and use 2ml of 20mM CaCl 2Resuspend the bacteria, and distribute 200 μl per tube into sterile small centrifuge tubes.

[0131] 3.2 Transfer of recombinant plasmids into LBA4404 cells

[0132] Add 2 μg of recombinant plasmids pCRar, pCSgt, and pCRac DNA to 200 μl LBA4404 competent cells, put t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention obtains through separation sea island cotton defense response regulating genes GbRar1, GbSgt1 and GbRac1, and constructs three plant expression vectors of constitutive expression separately. Through transforming tobacco in root nodule agrobacterium process, these three kinds of defense response regulating genes are overexpressed in tobacco, and the transgenic tobacco has obviously raised tobacco red spot resistance. Obviously, these three kinds of defense response regulating genes and the technological path may be used also in disease resisting gene engineering breeding of other crops, and are significant in practice and marketing.

Description

technical field [0001] The present invention relates to a nucleotide sequence encoding a sea-island cotton gene, a construct containing the nucleotide sequence, a recombinant expression vector containing the construct and a plant cell containing the construct or the recombinant expression vector. The present invention particularly relates to the nucleotide sequence encoding GbRar1, GbSgt1, GbRac1 genes of sea-island cotton and its application in cultivating disease-resistant transgenic plants, including constructs containing the nucleotide sequences encoding sea-island cotton GbRar1, GbSgt1, and GbRac1 genes, The recombinant expression vector containing said construct, the plant cell transformed by the expression vector, and the transgenic plant showing high resistance to pathogenic bacteria produced by the transformed cell and its progeny, including plant seeds, whole plants or plant parts or tissues and organs. Background technique [0002] After a plant is infected by a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H1/00C12N5/10C12N15/29C12N15/82
Inventor 贾士荣李为民王志兴
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com