Methods for detection of a target nucleic acid by capture using multi-subunit probes

a multi-subunit, target nucleic acid technology, applied in the field of methods of detecting or measuring a target nucleic acid, can solve the problems of inaccessible probes, amplified materials require additional manipulation, and none of these patents teach the generation of signals, so as to improve the performance of allele-discriminating probes. the effect of strong stabilizing

Inactive Publication Date: 2008-04-24
STRATAGENE INC US
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention provides a method for detecting a specific nucleic acid sequence in a sample. The method involves using a probe that is designed to bind to the target nucleic acid sequence and release a signal when it does so. The probe is made up of two or more subunits that are complementary to the target nucleic acid sequence. When the probe is not bound to the target nucleic acid, the subunits do not dissociate from each other. The method uses a detection complex formed by the probe and the target nucleic acid, and the signal is generated by the release of the first subunit of the probe. The method is sensitive and specific, and can be used in various applications such as diagnostics and research.

Problems solved by technology

Furthermore, none of these patents teach generation of a signal as a result of hybridization of the probe to the target, displacement of at least one subunit of the probe by the synthetic activity of a polymerase and subsequent dissociation of at least one subunit of the probe.
Additionally, none of these patents teach a probe comprising a binding moiety that is inaccessible unless the probe has hybridized to a target and undergone a conformational change wherein at least the subunit of the probe comprising the binding moiety dissociates from at least a second subunit of the probe.
While the PCR technique is an extremely powerful method for amplifying nucleic acid sequences, the detection of the amplified material requires additional manipulation and subsequent handling of the PCR products to determine whether the target DNA is present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for detection of a target nucleic acid by capture using multi-subunit probes
  • Methods for detection of a target nucleic acid by capture using multi-subunit probes
  • Methods for detection of a target nucleic acid by capture using multi-subunit probes

Examples

Experimental program
Comparison scheme
Effect test

example 1

Probe Design and Preparation

[0428] The invention provides for a probe comprising at least two subunits, one of which comprises a binding moiety, wherein a subunit of the probe dissociates from the remaining subunits of the probe upon binding of the probe to a target nucleic acid. The invention also provides for a probe comprising at least two subunits, a secondary structure that changes upon binding of the probe to a target nucleic acid and a binding moiety. A probe according to this embodiment of the invention also binds to a target nucleic acid such that a subunit of the probe dissociates from the remaining probe subunits.

[0429] A subunit of a probe according to one embodiment of the invention is 5-250 nucleotides in length and ideally 17-40 nucleotides in length. At least one subunit of the probe has a target nucleic acid binding sequence that is from 7 to about 140 nucleotides, and preferably from 10 to about 140 nucleotides. Probes may also comprise non-covalently bound or co...

example 2

Probe Design and Preparation

[0440] The invention provides for a probe comprising at least two subunits, one of which comprises a tag, and wherein a subunit of the probe dissociates from the remaining subunits of the probe upon binding of the probe to a target nucleic acid. The invention also provides for a probe comprising at least two subunits, a secondary structure that changes upon binding of the probe to a target nucleic acid and a tag. A probe according to this embodiment of the invention also binds to a target nucleic acid such that a subunit of the probe dissociates from the remaining probe subunits.

[0441] A subunit of a probe according to one embodiment of the invention is 5-250 nucleotides in length and ideally 17-40 nucleotides in length. At least one subunit of a probe has a target nucleic acid binding sequence that is from 7 to about 140 nucleotides, and preferably from 10 to about 140 nucleotides. Probes may also comprise non-covalently bound or covalently bound subun...

example 3

[0452] A target nucleic acid can be detected and / or measured by the following method. A labeled detection complex is formed by annealing at 95° C. for 5 minutes and then cooling to approximately 50-600 C (a) a sample containing a target nucleic acid (ABC in FIG. 1B) and (b) a downstream, labeled oligonucleotide probe comprising two subunits and a binding moiety (for example the combination of A′B″ and B′C′ in FIG. 1B, comprising a nucleic acid sequence 5′AGCTACTGATGCAGTCACGT3′), wherein the probe specifically hybridizes to a region of the target nucleic acid. Annealing is carried out in the presence of 1× Sentinal Molecular beacon core buffer or 10×Pfu buffer. Following annealing, the labeled first subunit of the probe dissociates from a second subunit of the probe and is released to generate a signal.

[0453] Alternatively, a labeled detection complex is formed by annealing a target nucleic acid to a labeled oligonucleotide probe comprising two subunits and having a secondary struct...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
dissociation constantaaaaaaaaaa
dissociation constantaaaaaaaaaa
dissociation constantaaaaaaaaaa
Login to View More

Abstract

The invention relates to generating a signal indicative of a target nucleic acid sequence, comprising forming a complex by incubating a sample comprising a target nucleic acid sequence with a probe comprising a first and second subunit, and a binding moiety, and dissociating the first and second subunit to release the first subunit and generate a signal. The invention also relates to a method of generating a signal indicative of the presence of a target nucleic acid sequence in a sample, comprising forming a complex by incubating a target nucleic acid sequence, an upstream primer and a probe comprising a first and second subunit, and a binding moiety. The primer is extended with a nucleic acid polymerase to displace a portion of the first subunit from the target nucleic acid strand thereby dissociating the first subunit from the second subunit to release the first subunit and generate a signal.

Description

RELATED APPLICATIONS [0001] This application is a divisional of U.S. application Ser. No. 10 / 197,026 filed Jul. 17, 2002 which claims the benefit of U.S. Provisional Application No. 60 / 306,087, filed on Jul. 17, 2001; U.S. Provisional Application No. 60 / 307,303, filed on Jul. 23, 2001; and U.S. Provisional Application No. 60 / 313,992, filed on Aug. 21, 2001. The entire teachings of the above applications are incorporated herein by reference.FIELD OF THE INVENTION [0002] The invention relates in general to methods of detecting or measuring a target nucleic acid. BACKGROUND OF THE INVENTION [0003] Methods of detecting and / or measuring a nucleic acid wherein an enzyme produces a labeled nucleic acid fragment in a cleavage reaction are known in the art. [0004] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717 and 5,888,780 disclose a method of cleaving a target DNA molecule by incubating a 5′ labeled target DNA with a DNA polymerase isolated from Thermus aquaticus (Taq polymerase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C07H21/04C12Q1/68
CPCC12Q1/6823C12Q2537/1373C12Q2537/137C12Q2565/1015C12Q2537/1376
InventorSORGE, JOSEPH A.WHALEN, ANNE M.
OwnerSTRATAGENE INC US