Capillary electrophoresis fluorescent detection system
a fluorescent detection and capillary electrophoresis technology, applied in the direction of luminescent dosimeters, optical radiation measurement, instruments, etc., can solve the problem of large signal to noise ratio relative, and achieve the effect of large signal to noise ratio, high throughput, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Double Stranded DNA Electropherogram and a Large Volume Detection System
[0042]FIG. 10 shows the electrophoretic pattern of double-stranded DNA 100 b.p. ladders obtained by an embodiment of the invention. This was measured in a multicapillary system, and each trace represents a different capillary. In this example only one LED light source and fiber optical bundle was used for the fluorophore excitation. The LED emitted at 470 nm for excitation while a band pass filter transmitted from 500 nm to 600 nm was used to select the desire fluorescent wavelength for detection. The separation matrix contained SYBR Green dye. When double-stranded DNA binds to SYBR Green, the resulting DNA dye complex absorbs the LED light and fluoresces at 522 nm. The samples were injected into one end of the capillaries by applying 5 kV for 5 seconds. After the sample injection, the injection ends of the capillaries were immersed into buffers for separation under 150 V / cm of a constant electric field. The vol...
example 2
Carbohydrate Separation Electropherogram With Large Volume Fluorescence Detection
[0043]FIG. 11 shows the high resolution oligosaccharide profiling by electrophoretic separation of carbohydrate MALTRIN® M-200 labeled with 8-aminopyrene-1,3,6-trisulfonate (APTS) using an embodiment of the invention. In this example only one LED and fiber optical bundle was used for the excitation. A LED with 470 nm emission was used for the excitation while monitoring the fluorescence signal through a band pass filter with bandwidth from 500 nm to 600 nm. The volume of liquid illuminated was 1500 micrometers×πr2, where r is one-half of the inner diameter of the sample vessel, which was 75 um. The samples were injected into one end of the capillaries by applying 5 kV for 10 seconds. After the sample injection, the injection ends of the capillaries were immersed into buffers for separation under 300 V / cm of a constant electric field. The fluorescent signal was recorded by the CCD. MALTRIN® M-200 is a ma...
example 3
Multiple Wavelength Detection
[0044]The Staphylococcus aureus tuf gene has the following DNA sequence:
5′-TATTCTCAATCACTGGTCGTGGTACTGTTGCTACAGGCCGTGTTGAA3′-ATAAGAGTTAGTGACCAGCACCATGACAACGATGTCCGGCACAACTTCGTGGTCAAATCAAAGTTGGTGAAGAAGTTGAAATCATCGGTTTACATGAGCACCAGTTTAGTTTCAACCACTTCTTCAACTTTAGTAGCCAAATGTACTCACATCTAAAACAACTGTTACAGGTGTTGAAATGTTCCGTAAATTATTAGGTGTAGATTTTGTTGACAATGTCCACAACTTTACAAGGCATTTAATAATCACTACGCTGAAGCT-3′TGATGCGACTTCGA-5′
[0045]The following DNA sequences were selected as primers for PCR amplification:
5′-TATTCTCAATCACTGGTCGT-3′5′-AGCTTCAGCGTAGTCTA-3′.
5′-TATTCTCAATCACTGGTCGT-3′ was labeled with a fluorescence dye (FAM) in the 5′ position, and 5′-AGCTTCAGCGTAGTCTA-3′ was labeled with a different fluorescence dye (Cy-5) at the 5′ position. After the PCR amplification for Staphylococcus aureus DNA, one strand of PCR product contained a green fluorescence dye while other strand of DNA contained a red fluorescence dye. After purification of the PCR product, 80% of N-methylformami...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More