Exon skipping oligomer conjugates for muscular dystropy
a technology of oligomer conjugates and oligomerization, applied in the field of new anti-sense oligomer conjugates, can solve the problems of disrupting the production of functional dystrophins and ineffective techniques
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
[0373]Using the PMO synthesis method B protocol described above, PMO #1 was synthesized.
[0374]where each Nu from 1 to 22 and 5′ to 3′ is (SEQ ID NO: 1):
Position No. 5′ to 3′Nu1C2A3A4T5G6C7C8A9T10C11C12T13G14G15A16G17T18T19C20C21T22G
where A is
C is
[0375]
G is
[0376]
and T is
[0377]
HPLC: 71.85%; Conditions: Dionex DNAPac (DNX #97) Gradient: 75% A+20% B+5% C at 0 min; 50% A at 20 min; 25% A+75% C at 21 min; Mobile phase A: 10 mM NaOH / 20 mM NaCl; C: 10 mM NaOH / 0.5 M NaCL. Column Temp: 45C; Flowrate 1.0 mL / min.
example 2
[0378]Using the protocol described above, PPMO #1 can be synthesized from PMO #1.
where each Nu from 1 to 22 and 5′ to 3′ is (SEQ ID NO: 1):
Position No. 5′ to 3′Nu1C2A3A4T5G6C7C8A9T10C11C12T13G14G15A16G17T18T19C20C21T22G
wherein A is
C is
[0379]
G is
[0380]
and T is
[0381]
example 3
kipping In Vitro
[0382]Two compounds that target human dystrophin exon 45 as described in the table below, PMO #1 and PPMO #1 both of which are assembled in the same sequence, are assessed for ability to induce exon 45 skipping.
TS SEQNameTargeting Sequence (TS)ID NO.5′3′PMO#1CAATGCCATCCTGGAGTTCCTG1EG3HPPMO#1CAATGCCATCCTGGAGTTCCTG1EG3-G-R6
Specifically, differentiated Human myocytes are used to determine the ability of the above compounds to induce exon 45 skipping at different concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm). After differentiation, the cells are incubated with the compounds for ninety-six hours followed by RNA isolation and exon 45 skipping is measured by RT-PCR as described above.
PUM
| Property | Measurement | Unit |
|---|---|---|
| time | aaaaa | aaaaa |
| time | aaaaa | aaaaa |
| time | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


