Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Peronospora resistance in spinacia oleracea

a technology of peronospora and spinacia oleracea, which is applied in the direction of peptide sources, bio chemistry apparatus and processes, etc., can solve the problems of major threat, unsuitable leaves for sale and consumption, and serious threat to the productivity of the spinach industry

Inactive Publication Date: 2021-09-16
RIJK ZWAAN ZAADTEELT & ZAADHANDEL BV
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention is about a new resistance allele that provides resistance to a newly emerged downy mildew isolate in spinach plants. The new allele is called alpha-WOLF 24 and was found through molecular biological tools. The invention aims to provide a new resistance profile to pathogenic races of Peronospora farinosa f.sp. spinaciae. The patent does not cover any previously known products, processes, or methods. The invention also includes a deposit of seeds that carry the alpha-WOLF 24 allele withNCIMB Ltd.

Problems solved by technology

spinaciae) is a major threat for spinach growers because it directly affects the harvested leaves.
Infection makes the leaves unsuitable for sale and consumption, as it manifests itself phenotypically as yellow lesions on the older leaves, and on the abaxial leaf surface a greyish fungal growth can be observed.
Especially the latest identified Peronospora races can break the resistance of many spinach varieties that are currently used commercially worldwide, and they thus pose a serious threat to the productivity of the spinach industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 2

tion of the LRR Domain-Encoding Region

[0088]The isolated genomic DNA of a spinach plant comprising the alpha-WOLF 24 allele, of which a representative sample of seed was deposited with the NCIMB under accession number NCIMB 43554 was used in polymerase chain reactions (PCR), using forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID NO: 4) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 5). The primer pair amplifies the LRR domain-encoding region of an alpha-WOLF gene, and has been designed for selectively amplifying part of a WOLF gene, and not of other CC-NBS-LRR protein-encoding genes.

[0089]PCR conditions for amplifying the LRR domain-encoding region of an alpha-WOLF gene using primers having SEQ ID NO: 4 and SEQ ID NO: 5 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):[0090]3 minutes at 95° C. (initial denaturing step)[0091]40 amplification cycles, each cycle consisting of: 30 seconds denaturation at 95° C., 30 seconds annealing at 60° C., and 30 seconds extensio...

example 3

ng an Alpha-WOLF 24 Allele in a Plant not Carrying the Allele

[0105]A spinach plant comprising the alpha-WOLF 24 allele, of which a representative sample of seed was deposited with the NCIMB under accession number NCIMB 43554 was crossed with a plant of variety Viroflay carrying the beta-WOLF 0 allele to obtain a F1 generation. Subsequently, a F1 plant was selfed to obtain a F2 population.

[0106]Plants of the F2 population were assayed as described in Example 1 for resistance to Peronospora farinosa f. sp. spinaciae Pfs:7. Approximately 75% of the plants scored completely resistant in the assay. This segregation pattern is consistent with that of a dominant inheritance.

[0107]Genomic DNA of each plant of the same F2 population was isolated and used in two different polymerase chain reactions (PCR). The first PCR reaction was done using primers for amplifying the LRR domain of an alpha-WOLF allele and the second PCR reaction was done using primers for amplifying the LRR domain of a beta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Login to View More

Abstract

The present invention relates to an allele designated alpha-WOLF 24 which confers resistance to at least one Peronospora farinosa f. sp. spinacea race, wherein the protein encoded by said allele is a CC-NBS-LRR protein that comprises in its amino acid sequence: a) the motif “MAEIGYSVC” SEQ ID NO: 1 at its N-terminus; and b) the motif “KWMCLR” SEQ ID NO: 2; and wherein the LRR domain of the protein has in order of increased preference at least 95%, 96%, 97%, 98%, 98.2%, 98.5%, 98.8%, 99%, 100% sequence similarity to SEQ ID NO: 10. The allele when present in a spinach plant confers complete resistance to at least Peronospora farinosa f. sp. spinacea race Pfs:1, Pfs:2, Pfs:5, Pfs:6, Pfs:7, Pfs:9, Pfs:11, Pfs:13, Pfs:15 and Pfs:17, and does not confer resistance to downy mildew race Pfs:16.

Description

RELATED APPLICATIONS AND INCORPORATION BY REFERENCE[0001]This application claims priority to international patent application Serial No. PCT / EP2020 / 056739 filed 12 Mar. 2020.[0002]The foregoing application, and all documents cited therein or during their prosecution (“appln cited documents”) and all documents cited or referenced in the appln cited documents, and all documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.FIELD OF...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H6/02C07K14/415A01H1/00A01H1/02
CPCA01H6/028A01H1/02A01H1/1255C07K14/415A01H5/12C12N15/8282C12Q1/6895C12Q2600/13C12Q2600/156
Inventor KOCK, VINCENT LAURENS ADRIANUSFRIJTERS, RAOUL JACOBUS JOHANNES MARIA
Owner RIJK ZWAAN ZAADTEELT & ZAADHANDEL BV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More