Peronospora resistance in spinacia oleracea
a technology of peronospora and spinacia oleracea, which is applied in the direction of peptide sources, bio chemistry apparatus and processes, etc., can solve the problems of major threat, unsuitable leaves for sale and consumption, and serious threat to the productivity of the spinach industry
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Examples
example 2
tion of the LRR Domain-Encoding Region
[0088]The isolated genomic DNA of a spinach plant comprising the alpha-WOLF 24 allele, of which a representative sample of seed was deposited with the NCIMB under accession number NCIMB 43554 was used in polymerase chain reactions (PCR), using forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID NO: 4) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 5). The primer pair amplifies the LRR domain-encoding region of an alpha-WOLF gene, and has been designed for selectively amplifying part of a WOLF gene, and not of other CC-NBS-LRR protein-encoding genes.
[0089]PCR conditions for amplifying the LRR domain-encoding region of an alpha-WOLF gene using primers having SEQ ID NO: 4 and SEQ ID NO: 5 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):[0090]3 minutes at 95° C. (initial denaturing step)[0091]40 amplification cycles, each cycle consisting of: 30 seconds denaturation at 95° C., 30 seconds annealing at 60° C., and 30 seconds extensio...
example 3
ng an Alpha-WOLF 24 Allele in a Plant not Carrying the Allele
[0105]A spinach plant comprising the alpha-WOLF 24 allele, of which a representative sample of seed was deposited with the NCIMB under accession number NCIMB 43554 was crossed with a plant of variety Viroflay carrying the beta-WOLF 0 allele to obtain a F1 generation. Subsequently, a F1 plant was selfed to obtain a F2 population.
[0106]Plants of the F2 population were assayed as described in Example 1 for resistance to Peronospora farinosa f. sp. spinaciae Pfs:7. Approximately 75% of the plants scored completely resistant in the assay. This segregation pattern is consistent with that of a dominant inheritance.
[0107]Genomic DNA of each plant of the same F2 population was isolated and used in two different polymerase chain reactions (PCR). The first PCR reaction was done using primers for amplifying the LRR domain of an alpha-WOLF allele and the second PCR reaction was done using primers for amplifying the LRR domain of a beta...
PUM
Property | Measurement | Unit |
---|---|---|
Fraction | aaaaa | aaaaa |
Fraction | aaaaa | aaaaa |
Fraction | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com