Targeted anti-lung carcinoma SOD construction and expression method
A construction method and expression method technology, applied in the construction of anti-lung cancer SOD and its high-efficiency expression field, can solve the problems of large molecular weight, non-specific recognition ability, lack of specific effect on cancer, etc., to eliminate potential impact and ensure biological Active, reducing the effect of spatial interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1, Nostoc genome SDS-CATB preparation method:
[0046] (1) Take 1ml of Nostoc commune strain CHEN (Nostoc commune strain CHEN) culture, wash it twice with TE buffer, and grind thoroughly for later use; TE buffer: Tris 50mM, EDTA 20mM, pH 8.
[0047] Nostoc commune strain CHEN (Nostoc commune strain CHEN) was purchased from FACHB, Wuhan Institute of Hydrobiology, Chinese Academy of Sciences.
[0048] (2) Add 567 μl of TE buffer solution, mix well, and freeze-thaw repeatedly in liquid nitrogen for 3 times.
[0049] (3) Add 30 μl of 10% SDS and 3 μl of 20 mg / ml proteinase K, mix well, and incubate at 37° C. for 1 hour.
[0050] (4) Add 100 μl of 5mol / L NaCL, mix thoroughly, then add 80 μl of CATB / NaCL, mix evenly, and incubate at 65°C for 10 minutes.
[0051] CATB / NaCL: 2% CTAB, 100mmol / L Tris.HCl (pH 8.0), 20mmol / L EDTA, 1.4mol / L NaCl.
[0052] (5) Add an equal volume of chloroform / isoamyl alcohol (24:1), mix well, and centrifuge for 5 minutes. Transfer the...
Embodiment 2
[0060] Embodiment 2, construction pET-SOD engineering bacteria:
[0061] (1) Under sterile conditions, inoculate 2ml of Nostoc algae CHEN into 1000ml of BG11 medium, light at 25°C, 2000XL light intensity for 10 hours a day, and shake the flask once. After 45 days of culture, the lower layer of culture was removed, and the Nostoc genome was extracted by Kim's SDS-CATB method.
[0062] (2) Query the Fe-SOD gene sequences of existing species in the Genbank database, blastn to analyze their homology, predict their evolutionary trends, and based on the Fe-SOD gene of the species with the highest homology (Spirulinaplatensis, Nostoc linckia, etc.) Sequence designed primers SODn: (5'-CTAGCCATGGCATTTG TACAGC-3', containing Nco I restriction site) and SODx: 5'-CCGCTCGAGAGCTTTGGCCAAGTTTTC-3', containing Xho1 I restriction site). The Nostoc genome was used as a template and SODn and SODx were used as primers to amplify the Fe-SOD gene,
[0063] The PCR program is:
[0064] The first s...
Embodiment 3
[0071] Embodiment 3, construction of T-ScFv engineering bacteria:
[0072] (1) cDNA was reverse transcribed from total RNA of hybridoma cell line LC-1 (Liang CHEN, Gang LI, LeiTANG, Jue WANG, Xi Rui GE. The inhibition of lung cancer cell growth by intracellular immunization with LC-1 ScFv. Cell Research (2002), 12(1)47-54) as template, PCR amplification of LC-1 with Vl-1 (5'-GACATTGAGCTCACCCAGTCTC-3) and Vl-2 (5'-CTATTTGATCTCGAGCTTGGTC-3') as light chain primers Antibody light chain gene V1, Vh-1 (5'-CTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATTGAGCTCACCCAGTCTC-3) and Vh-2 (5'-TGAGGAGACGGTGACCGTGGTCCCTTGGCCCAG-3) were used as heavy chain primers to amplify LC-1 antibody heavy chain gene Vh by PCR. The PCR program is the same as in Example 2.
[0073] (2) Using Vl and Vh as primers without using a template, use SOE-PCR to connect Vl and Vh to construct ScFv. The SOE-PCR program is:
[0074] The first stage: 94°C for 5 minutes,
[0075]...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
