Unlock instant, AI-driven research and patent intelligence for your innovation.

Targeted anti-lung carcinoma SOD construction and expression method

A construction method and expression method technology, applied in the construction of anti-lung cancer SOD and its high-efficiency expression field, can solve the problems of large molecular weight, non-specific recognition ability, lack of specific effect on cancer, etc., to eliminate potential impact and ensure biological Active, reducing the effect of spatial interference

Inactive Publication Date: 2008-11-05
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Clinically, SOD as a tumor treatment drug has two application defects that are difficult to overcome at the same time: first, SOD has no specific recognition ability for pathological tissues or cells, and has low affinity for the target site, that is, tumor cells, and its medicinal tendency is not obvious. , lack of specific effect on cancer; second, it must enter the cell to play its biological role, and natural SOD cannot enter the cell due to its large molecular weight

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeted anti-lung carcinoma SOD construction and expression method
  • Targeted anti-lung carcinoma SOD construction and expression method
  • Targeted anti-lung carcinoma SOD construction and expression method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, Nostoc genome SDS-CATB preparation method:

[0046] (1) Take 1ml of Nostoc commune strain CHEN (Nostoc commune strain CHEN) culture, wash it twice with TE buffer, and grind thoroughly for later use; TE buffer: Tris 50mM, EDTA 20mM, pH 8.

[0047] Nostoc commune strain CHEN (Nostoc commune strain CHEN) was purchased from FACHB, Wuhan Institute of Hydrobiology, Chinese Academy of Sciences.

[0048] (2) Add 567 μl of TE buffer solution, mix well, and freeze-thaw repeatedly in liquid nitrogen for 3 times.

[0049] (3) Add 30 μl of 10% SDS and 3 μl of 20 mg / ml proteinase K, mix well, and incubate at 37° C. for 1 hour.

[0050] (4) Add 100 μl of 5mol / L NaCL, mix thoroughly, then add 80 μl of CATB / NaCL, mix evenly, and incubate at 65°C for 10 minutes.

[0051] CATB / NaCL: 2% CTAB, 100mmol / L Tris.HCl (pH 8.0), 20mmol / L EDTA, 1.4mol / L NaCl.

[0052] (5) Add an equal volume of chloroform / isoamyl alcohol (24:1), mix well, and centrifuge for 5 minutes. Transfer the...

Embodiment 2

[0060] Embodiment 2, construction pET-SOD engineering bacteria:

[0061] (1) Under sterile conditions, inoculate 2ml of Nostoc algae CHEN into 1000ml of BG11 medium, light at 25°C, 2000XL light intensity for 10 hours a day, and shake the flask once. After 45 days of culture, the lower layer of culture was removed, and the Nostoc genome was extracted by Kim's SDS-CATB method.

[0062] (2) Query the Fe-SOD gene sequences of existing species in the Genbank database, blastn to analyze their homology, predict their evolutionary trends, and based on the Fe-SOD gene of the species with the highest homology (Spirulinaplatensis, Nostoc linckia, etc.) Sequence designed primers SODn: (5'-CTAGCCATGGCATTTG TACAGC-3', containing Nco I restriction site) and SODx: 5'-CCGCTCGAGAGCTTTGGCCAAGTTTTC-3', containing Xho1 I restriction site). The Nostoc genome was used as a template and SODn and SODx were used as primers to amplify the Fe-SOD gene,

[0063] The PCR program is:

[0064] The first s...

Embodiment 3

[0071] Embodiment 3, construction of T-ScFv engineering bacteria:

[0072] (1) cDNA was reverse transcribed from total RNA of hybridoma cell line LC-1 (Liang CHEN, Gang LI, LeiTANG, Jue WANG, Xi Rui GE. The inhibition of lung cancer cell growth by intracellular immunization with LC-1 ScFv. Cell Research (2002), 12(1)47-54) as template, PCR amplification of LC-1 with Vl-1 (5'-GACATTGAGCTCACCCAGTCTC-3) and Vl-2 (5'-CTATTTGATCTCGAGCTTGGTC-3') as light chain primers Antibody light chain gene V1, Vh-1 (5'-CTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATTGAGCTCACCCAGTCTC-3) and Vh-2 (5'-TGAGGAGACGGTGACCGTGGTCCCTTGGCCCAG-3) were used as heavy chain primers to amplify LC-1 antibody heavy chain gene Vh by PCR. The PCR program is the same as in Example 2.

[0073] (2) Using Vl and Vh as primers without using a template, use SOE-PCR to connect Vl and Vh to construct ScFv. The SOE-PCR program is:

[0074] The first stage: 94°C for 5 minutes,

[0075]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a constructing and expressing cleanse method of pET-SOD engineering bacteria, which comprises the following steps: designing primer to acquire Fe-SOD gene from pET-SOD plasmid of nostoc CHEN Fe-SOD; designing primer to acquire ScFv gene from T-ScFv plasmid of ScFv; restructuring emzyme-cutting Fe-sod gene and ScFv gene; acquiring SOD-ScFv fusion gene; restructuring in pET28a(+) plasmid carrier; constructing to acquire Pet-SOD-ScFv fusion carrier; conversing to recipe bacillus coli BL21; obtaining Pet-SOD-ScFv engineering bacteria; filling IPTG and Fe3+ to evoke; gaining SOD-ScFv expression.

Description

technical field [0001] The invention relates to the field of genetic engineering pharmaceuticals, in particular to a method for constructing and highly expressing an anti-lung cancer SOD with high localization ability and membrane penetration ability. Background technique [0002] Clinically, SOD as a tumor treatment drug has two application defects that are difficult to overcome at the same time: first, SOD has no specific recognition ability for pathological tissues or cells, and has low affinity for the target site, that is, tumor cells, and its medicinal tendency is not obvious. , lack of specific effect on cancer; second, it must enter the cell to play its biological role, and natural SOD basically cannot enter the cell due to its large molecular weight. ScFv has a small molecular weight while maintaining the binding specificity of antigen and antibody, and is easy to reach the target tissue, so it is an ideal targeting molecule. LC-1 type ScFv, which can efficiently a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/62C12N1/21C12N9/08
Inventor 龚兴国
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More