Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus

An immune adjuvant and composition technology, applied in the field of immunology, can solve the problems of unstable effect of adjuvant, limited application, inability to enhance cellular immune response, etc., and achieve the effect of improving antigen immune activity, eliminating viruses and treating diseases

Inactive Publication Date: 2009-03-11
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, autologous vaccines cannot be widely used in different individuals, and often carry multivalent antigens, which is not conducive to targeted specific antigen immunotherapy
At present, most of the immunological adjuvants in clinical use are aluminum preparations. Due to the instability of the adjuvant effect and the inability to enhance the cellular immune response, its application is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus
  • Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus
  • Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] In this embodiment, mice are used as animal models, and HBV, HCV, HIV-1, SARS-CoV, and FMDV are studied, and the same conclusion is obtained. Now take HBV as an example:

[0020] 1. Cloning of experimental animal mouse gp96-N22-355 gene fragment

[0021] PET-30a plasmid (from novagen), laboratory preserved mouse pET-30a-gp96 (gp96 see patent number: ZL01104060.2). N-terminal genes were cloned in plasmids. The primers used are:

[0022] Primer 1: 5'CCGGATCCGAACTTGATGTGGATGGTACA3'

[0023] Primer 2: 5'CCGAGCTCCCAAATGGTGAGAGTATAATTTAC3'

[0024] The PCR reaction conditions were as follows: 94°C for 4 minutes; 30 cycles of 94°C for 50 seconds, 55°C for 50 seconds, and 72°C for 3 minutes; 72°C for 5 minutes. It turned out to be identical to the known sequence.

[0025] The PCR product is a fragment of about 1Kd, and two restriction sites of BamHI and SacI are artificially introduced into the 5' end and 3' end of the fragment, and the amplified fragment is sequenced. It...

Embodiment 2

[0043] At the cellular level, human DC cells, which play an important role in the antigen presentation process, were used as materials to study the effects of different fragments of heat shock proteins Hgp96 and Hhsp70 on the activation of DC cells. HBV, HCV, HIV-1, SARS-CoV, and FMDV have been studied, and the same conclusion has been obtained. Taking HBV as an example:

[0044] 8. Purification of Hgp96 full-length protein from human liver tissue

[0045] 50g of normal human liver tissue that died in a traffic accident was homogenized and centrifuged, and precipitated with 50%-70% (NH4)2S04. After the precipitate was dissolved, ConA Sepharose (Pharmacia Company) was used to perform affinity chromatography, and the bound protein was purified with 10% α-methyl glucoside was eluted, and the eluate was subjected to anion chromatography on POROS 20QE (BioCAD perfusion chromatography system of PE Company), and Hgp96 protein with >95% purity was obtained through these three steps of...

Embodiment 3

[0087] In this example, SPF chicken was used as an animal model, and Chsp108 N21-355 was used as an adjuvant to study MDV, AIV and NDV protein antigens, and the same conclusion was obtained. Now take MDV as an example:

[0088] 1. Chsp108 of the HSP90 family extracted from chicken liver and its gene sequence analysis

[0089] According to the above-mentioned extraction method, take 80 grams of chicken tumor liver tissues from health and chicken tumor liver tissues preserved at -70°C respectively, add 4 times the volume of hypotonic buffer, and homogenize them with a homogenizer in an ice bath. Slurry until more than 95% of the liver cells are broken. Centrifuge at 14,000 rpm for 30 minutes to remove cell debris and other impurities, and perform ultracentrifugation. The supernatant is precipitated with 50% to 70% saturated ammonium sulfate, and the precipitate is dissolved and passed through an affinity chromatography column. The bound glycoprotein was eluted with 10% sodium α...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

An immunoadjuvant used to prepare the antiviral vaccine or medicine for increasing the immune activity of the antigens for HBV, HCV, SARS coronavirus, fowl influenza virus, etc is a kind of human or animal's novel heat shock proteins gp96, hsp108 and hsp70.

Description

technical field [0001] The present invention belongs to the field of immunology. Specifically, it involves a class of human or animal heat shock proteins gp96 and hsp108 (both belonging to the HSP90 family) or hsp70 full-length molecule or its amino-terminal fragment as a new type of immune adjuvant to improve the immune activity of antigens. Viral epitope peptides, covalently linked multi-epitope recombinants or protein antigens are mixed or covalently or non-covalently linked with the above-mentioned heat shock protein full-length molecules or their amino-terminal fragments. Antigen immune activity to achieve the purpose of eliminating viruses and treating diseases. Background technique [0002] Heat shock protein (heat shock protein, HSP), also known as stress protein, is a kind of protein that is highly conserved in biological evolution and widely exists in prokaryotes and eukaryotes. According to its molecular weight and structure, it is mainly divided into nearly ten...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/39A61P31/12
Inventor 田波高福李宏涛张玉霞周明海
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com