Plants having increased yield and a method for making the same

A plant and yield technology, applied in the field of molecular biology, to achieve the effect of increased seed yield and increased yield

Inactive Publication Date: 2008-01-16
CROPDESIGN NV
View PDF11 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, such selective breeding techniques have several drawbacks in that they are generally labor intensive and the resulting plants often contain heterogeneous genetic components that do not necessarily produce expected trait

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plants having increased yield and a method for making the same
  • Plants having increased yield and a method for making the same
  • Plants having increased yield and a method for making the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0137] Example 1: Gene Cloning

[0138] The rice OsMADS18-like gene (CDS1522) was amplified by PCR using a rice seedling cDNA library (Invitrogen, Paisley, UK) as a template. After the RNA extracted from the seedlings was reverse transcribed, the cDNA was cloned into pCMV Sport 6.0. The library has an average insert size of 1.6kb, and the number of original clones is on the order of 1.67×10 7 cfu. in 6×10 10 After the first amplification of cfu / ml, the original titer was determined to be 3.34 × 10 6cfu / ml. After plasmid extraction, 200 ng template was used in 50 μl PCR mix. The primers used for PCR amplification include the AttB site of Gateway recombination, which is prm05821 (SEQ ID NO: 20; positive, the start codon is in bold, and the AttB1 site is in italics: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACAATGGGGAGAGGG CCG 3') and prm05822 (SEQ ID NO: 21; antisense, complementary, stop codon in bold, AttB2 site in italics: 5'GGGGACCACTTTGTACAAGAAAGCTGGGTTGAGTGGAGTGACGTTTGAGA3')...

Embodiment 2

[0139] Embodiment 2: vector construction

[0140] Next, the entry clone p05838 was used in the LR reaction together with the designated vector p05294 for rice transformation. This vector contains the following as functional elements within the T-DNA borders: plant selectable marker; selectable marker expression cassette; Gateway expression cassette designed for in vivo recombination LR with the sequence of interest cloned into the entry clone. The rice OSH1 promoter (PRO0129) (SEQ ID NO: 22) for early shoot apical meristem expression was upstream of this Gateway cassette (Matsuoka et al., Plant Cell 5 1993, 1039-1048).

Embodiment 3

[0142] Example 3: Evaluation and results of OsMADS18 under the control of the rice OSH1 promoter

[0143] Approximately 15 to 20 independent TO rice transformants were generated. Primary transformants were transferred from the tissue culture room to the greenhouse for growth and T1 seeds were harvested. Five events were retained in which the T1 generation segregated 3:1 for the presence / absence of the transgene. Approximately 10 T1 seedlings containing the transgene (heterozygous and homozygous) and approximately 10 T1 seedlings lacking the transgene (nullzygote) were selected in each event by monitoring the expression of the visible markers. The 4 T1 events were further evaluated in the T2 generation, following the same evaluation method as the T1 generation, but using more individuals per event.

[0144] Statistical analysis: F-test

[0145] A two-way ANOVA (Analysis of Variation) was used as a statistical model for the overall assessment of plant phenotypic properties. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention concerns a method for increasing plant yield by increasing activity in a plant of an OsMADS18-like polypeptide or a homologue thereof. One such method comprises introducing into a plant an OsMADS18-like nucleic acid or variant thereof. The invention also relates to transgenic plants having introduced therein an OsMADS18-like nucleic acid or variant thereof, which plants have increased yield relative to corresponding wild type plants. The present invention also concerns constructs useful in the methods of the invention.

Description

field of invention [0001] The present invention relates generally to the field of molecular biology and to methods of increasing the yield of plants relative to corresponding wild-type plants. More specifically, the present invention relates to a method for increasing plant yield by increasing the activity of an Oryza sativa (Os) MADS18-like polypeptide or a homologue thereof in a plant. The present invention also relates to plants having increased activity of an OsMADS18-like polypeptide or a homologue thereof, said plants having increased yield relative to corresponding wild-type plants. The invention also provides constructs useful in the methods of the invention Background of the invention [0002] The ever-increasing world population and dwindling arable land available for agriculture are forcing research towards increasing the efficiency of agriculture. Traditional approaches to crop and horticultural improvement utilize selective breeding techniques to identify plan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C07K14/415A01H5/10
CPCC12N15/8261Y02A40/146
InventorV·弗兰卡德
OwnerCROPDESIGN NV