Streptomyces clavuligerus, as well as preparation method and application thereof

A technology of Streptomyces clavulcane and strains, applied in the field of biopharmaceuticals, can solve the problems of low production of clavulanic acid and achieve the effects of short cycle, low work intensity and easy access

Active Publication Date: 2013-09-04
LUNAN PHARMA GROUP CORPORATION
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] In order to solve the problem of low yield of clavulanic acid produced by fermentation of Streptomyces clavulanic acid, one of the purposes of the present invention is to provide a high-yielding strain of Streptomyces clavulanic acid producing clavulanic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptomyces clavuligerus, as well as preparation method and application thereof
  • Streptomyces clavuligerus, as well as preparation method and application thereof
  • Streptomyces clavuligerus, as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Construction of argG gene insertion vector

[0033] Design primers according to the DNA sequence of Streptomyces clavuligerus argG gene (Z49111), and use the total DNA of Streptomyces clavuligerus as a template to amplify argG gene fragments in vitro by PCR, and then purify the PCR products, and then electrophoresis detection (attached) Figure 4 ).

[0034] According to the analysis of the argG gene sequence of Streptomyces coryneformis, the two primers for PCR amplification of the argG gene are designed as follows:

[0035] argG-up: CGCGGATCCCGTAAGCGTCCGATCACTTCG

[0036] argG-down: CCGGAATTCGCTGCTCACTGCGGGAACT

[0037] The PCR product was digested with BamHI and EcoRI, and then inserted into the same double digested pSET152 plasmid (attached figure 2 In ), the positive clone was obtained by blue-white spot screening, the plasmid was extracted, and the double enzyme digestion with BamHI and EcoRI was performed to verify. The size of the double digestion product was d...

Embodiment 2

[0038] Example 2 Preparation of Streptomyces protoplasts

[0039] Protoplast screening of transformed strains

[0040] Add 100ml YEME+TSBY (1:1) into a 250ml Erlenmeyer flask equipped with a stainless steel spring, and add 0.2% glycine, inoculate 100ul of spore suspension, and cultivate for 36h-40h on a shaker at 30°C and 200rpm. Then the mycelium was collected, and the collected mycelium was washed with 10.3% sucrose solution for three times, and centrifuged at 3000 rpm for 10 min to collect the mycelium. Take the mycelium, add lysozyme P buffer, and incubate in a 30℃ water bath for 30-60 minutes until the supernatant is milky. Filter with a test tube equipped with absorbent cotton, transfer the filtrate to a sterile universal, and centrifuge at 3000 rpm for 7 minutes to collect the protoplast precipitate, which is yellow. Gently disperse the protoplasts, then wash with P buffer to remove lysozyme, centrifuge under the same conditions, collect the protoplasts, remove the superna...

Embodiment 3

[0043] Example 3 Shake flask detection of genetically engineered bacteria

[0044] Perform shake flask experiments on the selected engineering bacteria to test their ability to produce clavulanic acid. The original strain was used as the control strain, and soybean medium was selected as the fermentation medium. The amount of liquid in the shake flask was 1:10, the inoculum was 5%, cultured at 28°C, 250rpm, and samples were taken at different times to test the clavulanic acid content. . There are two replicates for each group of trials. The results of HPLC detection showed that compared with the original strain, the yield of Streptomyces clavuligerus LNSC-02 was greatly improved, and it increased by 20% at 72h (attached Figure 5 , Attached Image 6 ).

[0045] Table 1 HPLC detection of clavulanic acid content in fermentation broth

[0046]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of microbial engineering, provides a superior streptomyces clavuligerus strain that is used for clavulanic acid production, a strain preparation method and application of the strain, and concretely relates to a method, which obtains high expression of key enzyme in the arginine synthesizing process by increasing the copy number of clavulanic acid synthesizing precursor of the streptomyces clavuligerus strain that is key enzyme gene argG in the arginine synthesizing process, and then obtains the streptomyces clavuligerus strain LNSC-2 with high yield of clavulanic acid. Compared with the original strains, the superior streptomyces clavuligerus strain that is provided by the invention can improve the yield of the zymolytic clavulanic acid production by over 20 percent.

Description

Technical field [0001] The invention belongs to the field of biopharmaceuticals, and relates to a kind of Streptomyces coryneformis, in particular to a Streptomyces coryneformis constructed by a genetic engineering method. The invention also relates to a preparation method and application of the Streptomyces coryneformis. Background technique [0002] β-lactam antibiotics, such as penicillin, cephalosporin, and cephalosporin, are the most widely used antibiotics in clinical practice. However, due to the emergence of pathogenic bacteria resistance, the use of such antibiotics has been greatly affected. The main reason for the emergence of drug resistance of pathogenic bacteria is the β-lactamase produced by it, which inactivates the β-lactam ring of β-lactam antibiotics by destroying it. Clavulanic acid is a natural β-lactamase inhibitor produced by Streptomyces coryneformis, which can irreversibly bind to the serine active site of β-lactamase to protect the activity of β-lactam...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12P17/18C12R1/465
Inventor赵志全
OwnerLUNAN PHARMA GROUP CORPORATION