Method for detecting toxicity of fluorescence quantum dots in organisms

A technology for fluorescent quantum dots and organisms, applied in the field of nanomaterials, can solve the problems of complex operation, high price, and many detection samples, and achieve the effects of high sensitivity, good stability and low cost

Inactive Publication Date: 2013-02-13
WUHAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above methods are complicated to operate, require expensive instruments, are expensive, have many detection samples, and have disadvantages such as poor repeatability.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting toxicity of fluorescence quantum dots in organisms
  • Method for detecting toxicity of fluorescence quantum dots in organisms
  • Method for detecting toxicity of fluorescence quantum dots in organisms

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] This example relates to the detection of the toxicity of different concentrations of BSA-modified Cd / Se quantum dots to zebrafish.

[0042] 1. Primer design and synthesis

[0043] The full-length sequence of the zebrafish MT gene induced by Cd was retrieved in NCBI, the amplification primers were designed with Premier Premier5 software, and the primer sequences synthesized by Yingjun Company were as follows:

[0044] MT primer sequence:

[0045] sense primer: 5′CCTGCGAATGTGCCAAGACTG 3′

[0046] Anti-sense primer: 5′GCATCGTTTTTCCCTCTTTAGCCTT 3′

[0047] β-ACTIN:

[0048] forward primer 5-CTTGGGTATGGA ATCTTGCG-3

[0049] reverse primer 5-AGCATTTGCGGTGGACGA T-3

[0050] 2. Total RNA extraction

[0051] 1. At 2.14×10 -7 M, 5.5×10 -8 M, 1.1×10 -8 M, 5.5×10 -9 M, 2.75×10 -10 M different concentrations of quantum dot culture plates were put into zebrafish juveniles that had grown to 3 days (just out of the membrane), and each 100 fish were placed in 10mL solution; t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting the toxicity of fluorescence quantum dots in organisms. Heavy metals in the fluorescence quantum dots are used for inducing the MTmRNA transcription in the organisms, and the toxicity of the fluorescence quantum dots in the organisms is reflected through detecting the expression conditions of the MTmRNA. The invention also provides a reagent kit for detecting the toxicity of the fluorescence quantum dots in the organisms. The invention evaluates the toxicity of the fluorescence quantum dots on the organisms at the molecule level, has the advantages of convenience, high speed, good stability and low cost, and can not be influenced by other factors. Because the MT is sensitive on trace heavy metals, and can be easily induced, the detection sensitivity of the MT is high, the detection sample consumption is little (dozens of milligrams), and the invention is widely applicable to the evaluation of the toxicity of the fluorescence quantum dots in the organisms.

Description

technical field [0001] The invention relates to a method for detecting the toxicity of fluorescent quantum dots in animals, and belongs to the technical field of nanometer materials. Background technique [0002] Quantum dots (quantum dots, QDs) are also called semiconductor nanocrystals. Due to their semiconductor characteristics and unique optical properties, especially as a new type of fluorescent probe, they have a wide range of excitation light bands and narrow emission spectrum widths. , high fluorescence intensity, good stability and long life are obviously superior to traditional organic dyes and fluorescent proteins. Therefore, it has been widely used in optoelectronic materials, medicine and life sciences. At present, the most widely used quantum dot is a shell structure with CdSe, CdTe, etc. as the core, and ZnS, ZnSe, etc. as the surface thin layer. This structure has a high luminescence yield and good photochemical stability. However, as nanomaterials containi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68
Inventor邓凤姣高超张哲姜鹏刘义
OwnerWUHAN UNIV