Method for detecting toxicity of fluorescence quantum dots in organisms
A technology for fluorescent quantum dots and organisms, applied in the field of nanomaterials, can solve the problems of complex operation, high price, and many detection samples, and achieve the effects of high sensitivity, good stability and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] This example relates to the detection of the toxicity of different concentrations of BSA-modified Cd / Se quantum dots to zebrafish.
[0042] 1. Primer design and synthesis
[0043] The full-length sequence of the zebrafish MT gene induced by Cd was retrieved in NCBI, the amplification primers were designed with Premier Premier5 software, and the primer sequences synthesized by Yingjun Company were as follows:
[0044] MT primer sequence:
[0045] sense primer: 5′CCTGCGAATGTGCCAAGACTG 3′
[0046] Anti-sense primer: 5′GCATCGTTTTTCCCTCTTTAGCCTT 3′
[0047] β-ACTIN:
[0048] forward primer 5-CTTGGGTATGGA ATCTTGCG-3
[0049] reverse primer 5-AGCATTTGCGGTGGACGA T-3
[0050] 2. Total RNA extraction
[0051] 1. At 2.14×10 -7 M, 5.5×10 -8 M, 1.1×10 -8 M, 5.5×10 -9 M, 2.75×10 -10 M different concentrations of quantum dot culture plates were put into zebrafish juveniles that had grown to 3 days (just out of the membrane), and each 100 fish were placed in 10mL solution; t...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com