Antimicrobial peptide gene from pinctada fucata and application

A technology of Hepu pearl oyster and Pu pearl oyster, applied in the preparation of antibacterial agents or fungicides, shellfish transgenic breeding, the field of Hepu pearl oyster antimicrobial peptide gene and the vector and recombinant strain containing the gene, capable of Solve problems such as high mortality and achieve significant economic value

Active Publication Date: 2011-01-19
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in recent years, diseases of Hepu pinnacle oyster have occurred frequently, causing high mortality and becoming one of the technical bottlenecks restricting the sustainable development of Hepu pinnacle oyster aquaculture industry. an effective antimicrobial agent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antimicrobial peptide gene from pinctada fucata and application
  • Antimicrobial peptide gene from pinctada fucata and application
  • Antimicrobial peptide gene from pinctada fucata and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1: Hepu Pinctada cDNA library construction and EST screening

[0061] The total RNA ( Figure 1a ),use Synthesis kit (Stratagene), Gigapack III Gold Cloning kit (Stratagene) and Kits such as mRNA isolation system III (Promega) were used to construct EST libraries ( Figure 1b ). Randomly pick single clones, use primer T 3 (AATTAACCCTCACTAAAGGG) was sequenced, and the carrier was removed through the Crossmatch program; through the Phrap program, the splicing and clustering was performed to obtain the UniGene data set. After the Phrap program was processed, the EST sequences that could be gathered together were Contigs sequences, and the EST sequences that could not be gathered together were Singlets sequence, the two parts of the sequence are combined to obtain the UniGene data set after EST de-redundancy. The obtained Contigs and Singletons were analyzed by BLASTn and BLASTx in the database, and one of the EST sequences was identified to have high homol...

Embodiment 2

[0062] Example 2: PCR amplification of Hepu Pinctada cDNA library

[0063] Using the Hepu Pinctada cDNA obtained by reverse transcription with the GeneRacer Kit as a template, the primers were the 5'-Primer and 3'-Primer of the GeneRacer Kit, respectively, and amplified by touchdown PCR to establish the Hepu Pinctada cDNA library. The reaction conditions were as follows: Pre-denaturation at 94°C for 5 minutes, followed by 40 cycles, divided into two stages: ① Denaturation at 94°C for 30 seconds, decrease by 0.5°C per cycle from 68°C to 54°C, annealing for 30 seconds, extension at 72°C for 2 minutes, a total of 32 cycles; ② 94°C Denaturation for 30S, annealing at 50°C for 30S, extension at 72°C for 2min, a total of 8 cycles. Finally, extend at 72°C for 10 min. Electrophoresis of PCR amplification products figure 2 .

Embodiment 3

[0064] Example 3: PCR amplification of the 3' end of the antimicrobial peptide from Hepu Pearl Oyster

[0065] The operation was carried out according to the instructions of GeneRacer Kit. According to the requirements of the kit, two upstream primers GSP1 and GSP2 were used for nested PCR according to the sequenced EST sequence of the antimicrobial peptide of Hepu pinctadae. The first upstream primer (GSP1) is 20 bases (5'-TGTGAATGCCTGGTGGTCTA-3') from the 96th base of the sequenced Hepu pearl oyster antimicrobial peptide EST sequence, and the second upstream primer (GSP2) is 20 bases from position 164 (5'-GCCGTGCTGCTACTGGTTAT-3').

[0066] For the first PCR, the PCR product dilution product (1:100) obtained in the above-mentioned embodiment 2 was used as a template, and the primer was GSP1, and the nucleotide sequence from the 96th to the 3'-polyA end was amplified by PCR, and the PCR method of Eppendorf was used. The PCR amplification program was set on the instrument, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Aperture diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses cDNA of antimicrobial peptide gene AP from pinctada fucata, the nucleotide sequence is as shown in SEQ ID NO. 1, and the amino acid sequence can be deduced to be as shown in SEQ ID NO.2. The invention further discloses an expression vector containing the antimicrobial peptide gene from the pinctada fucata and a recombinant microbe transformed by utilizing the vector, discloses a method for preparing the antimicrobial peptide gene from the pinctada fucata by utilizing the microbe, and simultaneously discloses an application of the antimicrobial peptide gene from the pinctada fucata in the preparation of drugs for treating or preventing sea water pearl oyster type anti-gram-negative bacteria. The invention adopts the genetic engineering technology for producing recombinant antimicrobial peptide protein from the pinctada fucata, and the recombinant antimicrobial peptide protein is utilized for preparing sea water pearl oyster antibacterial agents or fungicides.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a Hepu pearl oyster antimicrobial peptide gene, a carrier containing the gene, a recombinant strain, and the application of the gene in the preparation of antibacterial agents or bactericides, which can also be used as a target gene Applied to shellfish transgenic breeding. Background technique [0002] Antimicrobial peptide (AP) is a kind of biologically active small molecule polypeptide induced in vivo, with a molecular weight of about 2000-7000, generally composed of 20-60 amino acid residues, and a molecular weight of about 4KDa. Features: ①The N-terminus is rich in polar amino acids and is strongly alkaline; ②The C-terminus is usually amidated and has neutral hydrophobicity; ③The middle link is rich in Pro, and most of the ends are amidated, which directly affects the bactericidal activity of antimicrobial peptides ; ④ The amino acid at the second pos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435C12N15/63A61K38/17A61P31/04
Inventor江世贵张殿昌崔淑歌
OwnerSOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI