Rockfish insulin like growth factor I receptor gene and its application
A growth factor receptor, insulin-like technology, applied in genes. fields, achieve significant economic benefits, promote rapid growth, and achieve significant economic value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040]Example 1: Synthesis of the middle fragment of the grouper insulin-like growth factor I receptor gene According to the IGF-IR gene sequences of twelve species that have been registered in GeneBank, they are compared with Dnassist software for similarity, in the conserved region Design and synthesize a set of degenerate primers for nested PCR amplification. Sense primer Primer1703:
[0041] 5'T(G / T)AA(A / G)CC(C / T)TGGAC(A / C / T)CA(A / G)TA(C / T)GC3'(22bp);
[0042] Antisense primer Primer2935:
[0043] 5'CACTGAA(A / G)TA(C / T)TC(A / C / G / T)GG(A / G)TT(A / C / G)AC3'(22bp);
[0044] Antisense primer Primer3100:
[0045] 5'TC(A / G)TT(A / C / G / T)AC(A / C / T)GTCTT(A / G / T)ATGGC3'(20bp). The reaction conditions are: 95°C pre-denaturation for 5 minutes; the following is 38 cycles, divided into two stages: (1) 95°C denaturation for 30 seconds, 1°C drop from 50°C to 37°C every two cycles, annealing for 30 seconds, A total of 28 cycles, 72°C extension for 1 minute; (2) 95°C denaturation for 30 seconds, ...
Embodiment 2
[0047] Example 2: The synthesis operation of the 5' end fragment of the grouper insulin-like growth factor I receptor gene was carried out according to the GeneRacer Kit Protocol. According to the requirements of the kit, two specific downstream primers were designed based on the sequenced intermediate fragment of IGF-IR cDNA: antisense primer Primer 5R336: 5'CCTCTTCCTGGTCTCCCACACCTATG3' (26bp), nested antisense primer Primer 5R104n:
[0048] 5'GGTGCGGATGTAGACCACTTTGC3' (23bp).
[0049] Nested PCR was performed according to the general primers of the GeneRacer Kit kit and these two specific downstream primers, and finally a band with a molecular weight of about 2.4 kb was obtained. The first PCR reaction conditions are: 95°C pre-denaturation for 5 minutes; the following is 40 cycles, divided into two stages: (1) 95°C denaturation for 30 seconds, each cycle from 62°C to 47°C drops 0.5°C, annealing 30 seconds, a total of 32 cycles, 72°C extension for 1 minute; (2) 95°C denatura...
Embodiment 3
[0051] Example 3: Synthesis of Grouper Insulin-like Growth Factor I Receptor Gene Tyrosine Kinase Region Fragment
[0052] According to the obtained intermediate fragment and the sequence of the highly conserved region of the IGF-IRβ subunit-tyrosine kinase active region reported in other species, two specific sense primers and one degenerate antisense primer were designed to obtain grouper Fish IGF-IR tyrosine kinase active region fragment. Sense primer Primer 3R707: 5'GCCGTTCACAGTTTACCGCATCG3'(23bp), sense primer Primer 3R1109n:
[0053] 5'CGTCCTCTACGCTATGATCTTCG3'(23bp), antisense primer Primer3RYR1: 5'GGCTTGTTSTCMKCRCTGTAG3'(21bp), the first PCR reaction conditions are: 95°C pre-denaturation, 5min, followed by 30 cycles, 94°C denaturation, 30sec; 50°C -65°C annealing, 30sec; 72°C extension, 1min30sec, and finally 72°C extension, 10min. For the second PCR, the annealed amplification product of the first PCR at 52°C was diluted 50 times as a template, and the reaction cond...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com