Unmarked gene knock-out method of extremely acidophilic thiobacillus ferrooxidans

A technology of Thiobacillus ferrooxidans and marker-free genes, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of less antibiotic availability, antibiotic resistance gene residues, and inconvenient multi-gene knockout Research and other issues

Active Publication Date: 2013-01-09
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the instability of the plasmid vector in A.ferrooxidans above, the usability of fewer types of antibiotics, the residue of antibiotic resistance genes in the existing knockout method, and the inconvenience of carrying out multi-gene knockout research, the present invention provides a A marker-free gene knockout method for A.ferrooxidans based on the principle of homologous recombination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Unmarked gene knock-out method of extremely acidophilic thiobacillus ferrooxidans
  • Unmarked gene knock-out method of extremely acidophilic thiobacillus ferrooxidans
  • Unmarked gene knock-out method of extremely acidophilic thiobacillus ferrooxidans

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Unmarked knockout of the extreme acidophilic Thiobacillus ferrooxidans phosphofructokinase gene (pfkB, AFE_1807 gene)

[0041] (1) Construction of a suicide plasmid for knocking out the A.ferrooxidans ATCC 23270AFE_1807 gene

[0042] 1. Construction of the initial plasmid for A.ferrooxidans gene knockout

[0043] Primers were designed according to the sequence information of plasmid pSW29T published in GenBank: AY733073.1:

[0044] 29TKpnI:

[0045] 5′-CGGC GGTACCTAGGGATAACAGGGTAAT AGCGCTTTTCCGCTGCATAACCC-3′

[0046] 29TSalI:

[0047] 5′-CTAA GTCGACTGATCAACGCGTCTCGAG GCCGGCCAGCCTCGCAGAGCAGG-3′

[0048] The 29TKpnI and 29TSalI primers use the plasmid pSW29T as a template to amplify in vitro the fragment with the oriT region by PCR (polymerase chain reaction). The I-SceI recognition and action site sequence of 18 bp is added inside the Kpn I site of the upstream primer, and the Bcl I, Mlu I and Xho I recognition site sequences are added inside the Sal ...

Embodiment 2

[0117] Example 2: Unmarked knockout of the extreme acidophilic Thiobacillus ferrooxidans tetrathionite hydrolase gene (tetH, AFE_0029 gene)

[0118] (1) Construction of a suicide plasmid for knocking out the A. ferrooxidans ATCC 23270 AFE_0029 gene

[0119] 1. construction is used for the initial plasmid of A.ferrooxidans gene knockout (same as embodiment 1, omitted)

[0120] 2. Construction of a suicide plasmid for knocking out the AFE_0029 gene

[0121] Primers were designed according to the AFE_0029 gene and its upstream and downstream gene sequences in the genome sequence of A. ferrooxidans standard strain ATCC 23270 published in GenBank: CP001212.1:

[0122] HA1F:

[0123] 5′-GCT GAATTC CTCGTCCATCATTTTTTTGCGG-3′

[0124] HA1R:

[0125] 5′-TACAAGCTTC TCTAGA CAGATGGTGCGTTTTCC-3'

[0126] HA2F:

[0127] 5′-CGCGAATTC TCTAGA CCGTCTACCTGACCAACTC-3′

[0128] HA2R:

[0129] 5′-GCTAAGCTT GAGCTC CGTCACGTCACTGCGAAAT-3′

[0130] HA1F and HA1R primers, HA2F and HA2R p...

Embodiment 3

[0169] Example 3: Marker-free knockout of the metallo-beta-lactamase gene (AFE 0269 gene, abbreviated as sdo) of Thiobacillus ferrooxidans extreme acidophilus

[0170] (1) Construction of suicide plasmid for knocking out A. ferrooxidans ATCC 23270 AFE_0269 gene

[0171] 1. Construction of the initial plasmid for A. ferrooxidans gene knockout (same as Example 1, omitted)

[0172] 2. Construction of suicide plasmid for knocking out AFE_0269 gene

[0173] Primers were designed according to the AFE_0269 gene and its upstream and downstream gene sequences in the genome sequence of A. ferrooxidans standard strain ATCC 23270 published by GenBank: CP001212.1:

[0174] HB1F:

[0175] 5′-CAC GAATTC CACGGACTGGGCGGATTAT-3′

[0176] HB1R:

[0177] 5′-CAC TCTAGA ATCACCCCTTGTCGGCAATG-3′

[0178] HB2F:

[0179] 5′-CCG TCTAGA GAGGAGTACTTAAGATGAGCAAACA-3′

[0180] HB2R:

[0181] 5′-GAT GAGCTC TGGTCGGTGATGACGGTACGG-3′

[0182] The HB1F and HB1R primers, HB2F and HB2R primers, re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an unmarked gene knock-out method of extremely acidophilic thiobacillus ferrooxidans based on the principle of homologous recombination. The method comprises the following steps of: constructing initial plasmids, suicide plasmids containing homologous fragments at upstream and downstream parts of target genes to be knocked out, and induction plasmids containing yeast endonuclease I-SceI genes; jointing and transferring the suicide plasmids and the induction plasmids to acidophilic thiobacillus ferrooxidans; and screening and identifying single commutators generating homologous recombination for the first time and double-exchange mutant strains generating homologous recombination for the second time. The method disclosed by the invention realizes the unmarked gene knock-out of acidophilic thiobacillus ferrooxidans for the first time, can realize the purpose of quickly, stably and efficiently knocking out the genes of the thiobacillus ferrooxidans, and can be used for researching the functional and metabolic mechanisms of the genes of the thiobacillus ferrooxidans, improving the genetic characters and constructing efficient bioleaching engineering bacteria; and moreover, the obtained mutant strain does not carry any resistance gene, thus the obtained mutant strain not only can be used as an original strain to knock out and improve genes in subsequent different sites, but also can be safely used for large-scale industrial production.

Description

technical field [0001] The invention relates to a gene knockout method based on the principle of homologous recombination, in particular to a marker-free gene knockout method of Thiobacillus ferrooxidans extreme acidophilus based on the principle of homologous recombination. Background technique [0002] Acidithiobacillus ferrooxidans (A.ferrooxidans for short) is a typical type of obligate autotrophic bacteria that can convert ferrous ions (Fe 2+ ) and reducing sulfur compounds (RISCs) to obtain energy for growth during the oxidation process. It is the dominant high-efficiency leaching bacteria in the application of sulfide ore biometallurgy, and it is also a model bacteria for studying the mechanism of iron and sulfur oxidation metabolism in leaching microorganisms. However, A. ferrooxidans is obligately autotrophic, with very slow growth, low cell yield, and very difficult genetic manipulation, which greatly limits the basic research and industrial application of A. ferro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/74C12R1/01
Inventor刘相梅王慧妍于洋洋刘双双林建群林建强庞昕
OwnerSHANDONG UNIV