Recombinant adenovirus carrying CAS9 and its application

A recombinant adenovirus and recombinant lentivirus technology, applied to the recombinant adenovirus carrying CAS9 and its application field, can solve the problems of low efficiency, time-consuming and laborious, mutation, etc., and achieve the effects of high efficiency, low cost and fast speed

Active Publication Date: 2017-02-01
BEIJING PROTEOME RES CENT
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of this method in actual work will also be limited by several factors, such as the limitations of low efficiency, time-consuming and labor-intensive, and possible mutations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adenovirus carrying CAS9 and its application
  • Recombinant adenovirus carrying CAS9 and its application
  • Recombinant adenovirus carrying CAS9 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1, the preparation of sgRNA virus liquid and CAS9 virus liquid

[0032] 1. Selection of target sites

[0033] CCAAT-enhancer binding protein-A (CCAAT-enhancer binding protein-alpha, CEBPA) was used as the target sequence to verify the reliability and authenticity of the CRISPR / Cas9 system. In order to avoid off-target effects, two gRNA tandem target regions were selected.

[0034] The DNA sequences of the two gRNAs are as follows:

[0035] gRNA1: 5'-GAAAGGACGAAACACC GAAGGCGGCCGGGTCGATGTAGG gttttagagctagaaat-3';

[0036] gRNA2: 5'-GAAAGGACGAAACACC GCACAGCCGACAGCAGGAGAAGG gttttagagctagaaat-3'.

[0037] gRNA1 is shown in sequence 1 of the sequence listing (its target region is the 323-345th nucleotide from the 5' end of sequence 3 of the sequence listing). gRNA2 is shown in sequence 2 of the sequence listing (its target region is the 375th-397th nucleotide from the 5' end of sequence 3 of the sequence listing). The fragment of the gene encoding CEBPA pro...

Embodiment 2

[0072] Embodiment 2, in vitro activity detection

[0073] 1. Suspend AML12 cells in DMEM medium to obtain a cell concentration of 5×10 5 cells / ml of cell suspension.

[0074] 2. Group processing

[0075] Experimental group: Mix 1ml of the cell suspension obtained in Step 1, 1ml of the sgRNA virus solution obtained in Step 3 of Example 1, and 0.1ml of the CAS9 virus solution obtained in Step 5 of Example 1, and mix them at 37°C and 5% CO 2 Cultivate in the incubator for 48h;

[0076] Control group: Mix 1ml of the cell suspension obtained in Step 1, 1ml of the control virus solution obtained in Step 6 of Example 1, and 0.1ml of the CAS9 virus solution obtained in Step 5 of Example 1, and store at 37°C and 5% CO 2 Cultivate in the incubator for 48h.

[0077] 3. After completing step 2, take cells, extract genomic DNA, and perform PCR amplification using the primer pair composed of F1 and R1.

[0078] F1:5'-ATTCGCGACCCGAAGCTGCG-3';

[0079] R1: 5'-TGTTCTTGTCCACCGACTTCTTGGCT-...

Embodiment 3

[0081] Embodiment 3, in vivo activity detection

[0082] 1. Group processing

[0083] Experimental group: 4 C57 mice were taken, and each tail vein was injected with 0.1ml of the sgRNA virus solution obtained in Step 3 of Example 1 and 0.1ml of the CAS9 virus solution obtained in Step 5 of Example 1;

[0084] Control group: take 1 C57 mouse, and inject 0.1 ml of the control virus solution obtained in Step 6 of Example 1 and 0.1 ml of the CAS9 virus solution obtained in Step 5 of Example 1 into the tail vein of each mouse.

[0085] 2. Seven days after the injection of the virus solution, the liver of the mouse was taken.

[0086] 3. Take the liver obtained in step 2, extract genomic DNA, use the primer pair composed of F1 and R1 to perform PCR amplification, take the PCR amplification product, and perform T7E1 enzyme digestion (set a control treatment without T7E1 enzyme digestion), and then carry out 2% agarose gel electrophoresis, see the results figure 2 . The control g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CAS9-carrying recombinant adenovirus and application thereof. The invention protects a recombinant adenovirus carrying coding gene of CAS9 protein; and the CAS9 protein is disclosed as Sequence 7 in the sequence table. The coding gene of the CAS9 protein is disclosed as 789th-5045th nucleotides from the 5' terminal of Sequence 6 in the sequence table. The invention also protects application of the recombinant adenovirus in preparing a kit for knocking out target gene. The CRISPR (clustered regularly interspaced short palindromic repeat) method has the characteristics of high efficiency, high speed and low cost. The CAS9 recombinant adenovirus disclosed by the invention can be used in a protein function cell platform (1) for quick gene modification and high flux screening, a liver protein function platform (2) for implementing quick and specific gene knock-out at the liver, and a mouse gene modification platform (3) for preparing a gene knock-out / knock-in mouse.

Description

technical field [0001] The invention relates to a recombinant adenovirus carrying CAS9 and its application. Background technique [0002] With the continuous development and improvement of genome annotation projects and the implementation of proteome projects, researchers have begun to try to apply the results of omics research to basic scientific research as soon as possible. Various fields, as well as personalized medicine (personalized medicine). However, the massive amount of omics information also poses a big problem for researchers, that is, how to convert these boring data into meaningful protein functions or clinically relevant information? The core of solving this problem is to develop an efficient and reliable method as soon as possible to help researchers study the influence of genotype on phenotype. Targeted gene inactivation using homologous recombination mechanism (homologous recombination) is such a good method, which can help researchers to clarify the func...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N7/01C12N15/861
Inventor张普民程然然彭瑾闫永红卞广兴
OwnerBEIJING PROTEOME RES CENT