Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis
A technology of mycobacterium tuberculosis and mycobacteria, applied in the field of biomedical detection, can solve the problems of low efficiency, slow detection speed of tuberculosis diagnostic technology, high biological safety requirements, etc., and achieve the effect of easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] 1. Primer design
[0055] According to the gene sequence information of the main pathogenic bacteria of the genus Mycobacterium published by GenBank, four differential genes 16S rRNA (accession number HM803175), IS61109 (accession number DQ217928), Rv2652 (accession number AD000019.1), Rv3873 ( accession number DQ229941), and designed 4 pairs of specific oligonucleotide primers according to the sequences of these four gene fragments. The nucleotide sequences of the primer pairs are as follows:
[0056] Amplify the 16S rRNA gene fragment:
[0057] Primer 1: 5'ATCGACGAAGGTCCGGGTTCTCTC3' (corresponding to the sequence shown in SEQ ID NO: 5)
[0058] Primer 2: 5'CCGGCTTTTAAGGATTCGCTTAAC3' (corresponding to the sequence shown in SEQID NO: 6)
[0059] Amplify the IS6110 gene fragment:
[0060] Primer 3: 5'CGTCTCGGCTAGTGCATTGTCATAG3' (corresponding to the sequence shown in SEQ ID NO: 7)
[0061] Primer 4: 5'TACTACGACCACATCAACCGGGAG3' (corresponding to the sequence shown i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap