Unlock instant, AI-driven research and patent intelligence for your innovation.

Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis

A technology of mycobacterium tuberculosis and mycobacteria, applied in the field of biomedical detection, can solve the problems of low efficiency, slow detection speed of tuberculosis diagnostic technology, high biological safety requirements, etc., and achieve the effect of easy operation

Inactive Publication Date: 2012-07-04
HUAZHONG AGRI UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to overcome the shortcomings of the existing tuberculosis diagnostic technology, such as slow detection speed, l

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis
  • Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis
  • Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] 1. Primer design

[0055] According to the gene sequence information of the main pathogenic bacteria of the genus Mycobacterium published by GenBank, four differential genes 16S rRNA (accession number HM803175), IS61109 (accession number DQ217928), Rv2652 (accession number AD000019.1), Rv3873 ( accession number DQ229941), and designed 4 pairs of specific oligonucleotide primers according to the sequences of these four gene fragments. The nucleotide sequences of the primer pairs are as follows:

[0056] Amplify the 16S rRNA gene fragment:

[0057] Primer 1: 5'ATCGACGAAGGTCCGGGTTCTCTC3' (corresponding to the sequence shown in SEQ ID NO: 5)

[0058] Primer 2: 5'CCGGCTTTTAAGGATTCGCTTAAC3' (corresponding to the sequence shown in SEQID NO: 6)

[0059] Amplify the IS6110 gene fragment:

[0060] Primer 3: 5'CGTCTCGGCTAGTGCATTGTCATAG3' (corresponding to the sequence shown in SEQ ID NO: 7)

[0061] Primer 4: 5'TACTACGACCACATCAACCGGGAG3' (corresponding to the sequence shown i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedical detection, relates to the technical field of microbe molecule biology detection, in particular to a multiplex polymerase chain reaction (PCR) kit capable of quickly identifying and diagnosing mycobacterium tuberculosis, nontuberculous mycobacteria, mycobacterium bovis and Bacillus Calmette Guerin vaccine simultaneously, and discloses four primer pair sequences designed for specific segments of four differential genes, namely 16S rRNA, IS6110, Rv2652 and Rv3873 of the mycobacterium, and amplification conditions for multiplex PCR. By the invention, a mycobacteria tuberculosis complex sequence can be quickly and accurately amplified in a sputum sample of a tuberculosis patient, and species identification can be carried out; the sensitivity is 50 colony forming units/template, which is far higher than that of an acid-fast staining method, an inspection procedure for the mycobacterium tuberculosis is greatly simplified, and a detection speed is improved; and meanwhile, different mycobacterium strains can be identified through once PCR, and a technical means is provided for clinic quick diagnosis of tuberculosis and molecular epidemiology survey.

Description

technical field [0001] The invention belongs to the technical field of biomedical detection, in particular to the technical field of microbial molecular biology detection, in particular to a multiplex PCR for rapid differential diagnosis of Mycobacterium tuberculosis, Non-tuberculosis Mycobacterium, Mycobacterium bovis and BCG Detection kit. technical background [0002] Since the 1990s, molecular biology diagnostic technology represented by polymer chain reaction (PCR) has developed rapidly in the medical field. Until 1989 when researchers introduced this technology to the diagnosis of tuberculosis for the first time, it immediately became the focus of attention in the field of tuberculosis diagnosis. After years of scientific research and clinical testing, this technology has been perfected day by day, and its sensitive, fast and specific characteristics have been verified in most reports. [0003] In recent years, new situations have emerged in the prevalence of tubercu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 郭爱珍程实陈伟陈颖钰胡长敏涂玲玲晁金陈焕春
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More