Canine distemper attenuated vaccine strain and medical purpose

An attenuated vaccine and canine distemper virus technology, applied in the biological field, can solve the problems of decreased expression level, long passage weakening period, affecting the immunogenicity of canine distemper vaccine, etc., to achieve genetic stability and solve the effect of mutation

Inactive Publication Date: 2012-12-26
杨盛华 +2
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the continuous passage method of African green monkey kidney cells (Vero) is widely used for domestication and attenuation of canine distemper virus. Decreased protein expression level seriously affects the immunogenicity of canine distemper vaccine prepared on Vero cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Canine distemper attenuated vaccine strain and medical purpose
  • Canine distemper attenuated vaccine strain and medical purpose
  • Canine distemper attenuated vaccine strain and medical purpose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Screening of main popular strains:

[0035] 1) Extraction and reverse transcription of total RNA

[0036] The lung tissues of dogs clinically diagnosed as canine distemper were collected, ground with sterile PBS to make a 10% lung tissue suspension, and stored at -80°C. Take 100 μL of suspension from the stock solution, extract total RNA according to conventional methods, and use PrimeScript RT reagent kit for reverse transcription reaction. The reverse transcription system is as follows:

[0037] Table 1, RT reaction system

[0038]

[0039] Reverse transcription was carried out in a PCR machine, and the reaction conditions were reverse transcription at 37°C for 15 min, followed by heating at 85°C for 5 s to inactivate reverse transcriptase. After the reaction, the cDNA solution was stored at -20°C.

[0040] 2) PCR amplification of H gene

[0041] Using cDNA as a template, apply primers targeting the H gene

[0042] QH1: TTCTG AGGCA GATGA GTTCT TC,

[0043...

Embodiment 2

[0070] The N gene and NP gene of the total RNA of the clinical epidemic strains CC12 and CC12-30 screened in Example 1 were amplified and sequenced respectively. Wherein QN1 and QN2 are N gene amplification primers, and QNP1 and QNP2 are NP gene amplification primers. Electrophoresis of N, H and NP gene PCR products of CC12 and CC12-30 see figure 1 , figure 2 .

[0071] Primer name Primer sequence QN1 TTCTG AGGCA GATGA GTTCT TC QN2 CTTGG ATGCT ATTTC TGACA CT QNP1 ACAGGATTGCTGAGGACCTAT QNP2 CAAGATAACCATGTACGGTGC

[0072] The N gene sequence of the clinical epidemic strain is shown in SEQ ID NO: 3, and the fragment length is 829bp.

[0073] The NP gene sequence of the clinical epidemic strain is SEQ ID NO: 4, and the fragment length is 289bp.

[0074] The N gene sequence of CC12-30 is SEQ ID NO: 5, and the fragment length is 829bp

[0075] The sequence of the NP gene of CC12-30 is SEQ ID NO: 6, and the fragment length is 289bp. ...

Embodiment 3

[0078] Genetic Stability Verification of the Vaccine Strain of the Present Invention

[0079] 1) Cell passage verification

[0080] The CC12-30 of the present invention was continuously passed on for 10 generations on vero cells, and the total RNA was extracted from the vaccine virus of every 5 generations, and the method of Example 1 was used to amplify the H gene and determine the sequence, and the obtained sequence was found by sequence comparison. , its H gene is exactly the same as CC12-30.

[0081] 2) Passage verification of susceptible dogs

[0082] Take the FK81 cell culture of CC12-30, and inoculate 5 1-month-old beagle puppies intramuscularly, 2ml each, and kill the dogs 5 days later, collect lung tissue separately, prepare 10% lung tissue suspension, and freeze-thaw at -80°C Twice, collect 5000g of centrifuged supernatant, then get 40000g of precipitate and suspend it with PBS to 2ml, inoculate the puppies of the same month age again, collect and prepare PBS suspe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a canine distemper attenuated vaccine strain, and simultaneously discloses a preparation method and a medical purpose of the canine distemper attenuated vaccine strain. FK81 passage domestication attenuated canine distemper attenuated vaccine strain CC12-30 has typical characteristics of canine distemper viruses and is stable in heredity, inoculates dogs can produce high-titer neutralizing antibodies and can resist attacks of virulent strains, and the problem of variation between existing canine distemper vaccines and the canine distemper viruses popular in present clinical operation can be effectively resolved.

Description

technical field [0001] The invention provides an attenuated canine distemper vaccine strain, and also discloses a preparation method and medical application of the attenuated canine distemper vaccine strain, belonging to the field of biotechnology. Background technique [0002] Canine distemper is an important disease affecting the dog breeding industry, and vaccination is the most effective means to prevent canine distemper. However, due to the rapid mutation of canine distemper virus clinically, the widely used vaccine strains may not be able to completely protect the existing epidemic strains. Difficulties in prevention and control. At present, the continuous passage method of African green monkey kidney cells (Vero) is widely used for domestication and attenuation of canine distemper virus. The decreased protein expression level seriously affected the immunogenicity of the canine distemper vaccine prepared with Vero cells as the substrate. Contents of the invention ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/00C12N7/08C12N15/45A61K39/175A61P31/14G01N33/569
Inventor杨盛华张茂林陈启军
Owner杨盛华