Detection primer and method for detecting bombyx mori cytoplasmic polyhedrosis virus (BmCPV)

A technology for the detection of plasmopolyhedrons and primers, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of few reports on molecular biology detection methods, and achieve simple operation and high detection sensitivity Effect

Inactive Publication Date: 2014-01-01
JIANGSU UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, BmCPV is divided into 9 strains according to the number of nucleic acids, the shape of polyhedrons and the parts formed in the cells. The sequence has also been determined, but there are few reports on its molecular biology detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection primer and method for detecting bombyx mori cytoplasmic polyhedrosis virus (BmCPV)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Artificial propagation and purification of silkworm plasmopolyhedrosis virus

[0032] Biological materials: Bombyx mori cytoplasmic polyhedrosis virus was preserved and rejuvenated by the pathological laboratory of Sericulture Research Institute of Jiangsu University of Science and Technology (only to illustrate the method of the present invention), viral RNA rapid extraction kit (Beijing Bolingkewei Biotechnology Co., Ltd.), Reverse transcription kit (Beijing Aidelai Biotechnology Co., Ltd.)

[0033] (1) Inoculation method: with 4×10 7 A / mL polyhedron was added to silkworms from the fourth instar, and the suspension was applied to the front and back sides of mulberry leaves. After silkworms ate mulberry for 8 hours, the virus-free mulberry leaves were replaced;

[0034] (2) Collection method: dissect the silkworm on the 6th day of the 5th instar, take the midgut of the diseased silkworm, rinse with normal saline after dissection, grind in a sterile mortar, and cent...

Embodiment 2

[0052] The present invention is based on BmCPV-1 (serial number: GQ924586.1) provided by NCBI (http: / / www.ncbi.nlm.gov.cn), pine caterpillar CPV (serial number: AF389463.1), pine caterpillar CPV ( Serial number: AY147187.1) The RDRP complete gene sequence of the three viruses, the Bioedit software queries the conserved regions, a total of 20 conserved regions, and screens after designing primers to screen out the primers that meet the requirements.

[0053] The primers BmCPV-R, BmCPV-F, the upstream primer is 22bp, located at its 5' end from 366 to 388, the downstream primer is 22bp, located at the sequence from 714 to 736, the nucleotide sequence of the two primers is as SEQ ID Shown in No.1 and SEQ ID No.2, are respectively:

[0054] BmCPV-F: CAAGGTCACAAGTATGATTACT

[0055] BmCPV-R: CTGACATTATTGCTGTACCTAC

[0056] The amplified target fragment was about 370bp. After cloning, Shanghai Bioengineering Co., Ltd. performed sequence determination. The sequence comparison with th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a detection primer and a detection method for detecting bombyx mori cytoplasmic polyhedrosis virus (BmCPV). Nucleotide sequences of the detection primer are as shown in SEQ ID NO.1 and SEQ ID NO.2. By means of the specific primer, a specific segment from the 366th base to the 736th base of RNA-dependent RNA polymerase (RDRP) gene from 5' to 3' of the BmCPV can be effectively amplified, the size of the segment is 370bp, and the specific primer is used for detecting the RDRP gene of the BmCPV, detection sensitivity is high, operation is simple, and by means of the detection primer and the detection method for detecting the BmCPV, important technical foundation is provided for control effect of silkworm diseases caused by infection of the BmCPV.

Description

technical field [0001] The invention belongs to the technical field of molecular diagnosis and identification, and in particular relates to a pair of detection primers and a rapid detection method for detecting the silkworm plasmopolyhedrosis virus with the BmCPV RDRP gene as a target. Background technique [0002] Bombyx mori polyhedrosis is also known as silkworm midgut-type pustular disease. The pathogen is Bombyx moriCytoplasmic polyhedrosis virus (BmCPV for short), which is the type species of Cytoplasmic polyhedrosis virus in Reoviridae. Bombyx mori plasmopolyhedrosis is the second most serious viral disease of silkworm, which seriously harms production. The disease is a chronic disease. The pathogen is a polyhedrosis virus with inclusion bodies. The nucleic acid type is dsRNA, which consists of ten independent segments. The virus is infected by silkworms, infects the cylindrical cells of the midgut, forms polyhedrons in the cytoplasm, and causes cell rupture. The vi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
Inventor 潘中华郭锡杰耿涛吴萍沈中元朱峰
Owner JIANGSU UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products