Detection primer and method for detecting bombyx mori cytoplasmic polyhedrosis virus (BmCPV)
A technology for the detection of plasmopolyhedrons and primers, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of few reports on molecular biology detection methods, and achieve simple operation and high detection sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] 1. Artificial propagation and purification of silkworm plasmopolyhedrosis virus
[0032] Biological materials: Bombyx mori cytoplasmic polyhedrosis virus was preserved and rejuvenated by the pathological laboratory of Sericulture Research Institute of Jiangsu University of Science and Technology (only to illustrate the method of the present invention), viral RNA rapid extraction kit (Beijing Bolingkewei Biotechnology Co., Ltd.), Reverse transcription kit (Beijing Aidelai Biotechnology Co., Ltd.)
[0033] (1) Inoculation method: with 4×10 7 A / mL polyhedron was added to silkworms from the fourth instar, and the suspension was applied to the front and back sides of mulberry leaves. After silkworms ate mulberry for 8 hours, the virus-free mulberry leaves were replaced;
[0034] (2) Collection method: dissect the silkworm on the 6th day of the 5th instar, take the midgut of the diseased silkworm, rinse with normal saline after dissection, grind in a sterile mortar, and cent...
Embodiment 2
[0052] The present invention is based on BmCPV-1 (serial number: GQ924586.1) provided by NCBI (http: / / www.ncbi.nlm.gov.cn), pine caterpillar CPV (serial number: AF389463.1), pine caterpillar CPV ( Serial number: AY147187.1) The RDRP complete gene sequence of the three viruses, the Bioedit software queries the conserved regions, a total of 20 conserved regions, and screens after designing primers to screen out the primers that meet the requirements.
[0053] The primers BmCPV-R, BmCPV-F, the upstream primer is 22bp, located at its 5' end from 366 to 388, the downstream primer is 22bp, located at the sequence from 714 to 736, the nucleotide sequence of the two primers is as SEQ ID Shown in No.1 and SEQ ID No.2, are respectively:
[0054] BmCPV-F: CAAGGTCACAAGTATGATTACT
[0055] BmCPV-R: CTGACATTATTGCTGTACCTAC
[0056] The amplified target fragment was about 370bp. After cloning, Shanghai Bioengineering Co., Ltd. performed sequence determination. The sequence comparison with th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
