Anti-humanized multidrug resistant protein Fab antibody and preparation method thereof

A multi-drug resistance, antibody technology, applied in anti-animal/human immunoglobulins, botanical equipment and methods, biochemical equipment and methods, etc., to achieve the effect of small molecular weight, helpful for chemotherapy, and fast metabolism

Active Publication Date: 2013-04-17
DALIAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Firstly, the target gene fragment is cloned into the phagemid vector, and transformed into the F pili E. coli in the host; then the auxiliary M13 phage binds to the F pili of the host bacterium through a ligand structure composed of gp3, gp6, and gp7 at one end, and gradually releases its genome into the host bacterium; the phage replicates in the host bacterium, and the phage The plasmid vector also expresses the phage structural protein fused with the foreign protein, and the phage nucleocapsid will mistakenly package the phagemid vector into it, and this wrongly packaged phage can reinfect E. coli host bacteria, but cannot amplify new phages again

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-humanized multidrug resistant protein Fab antibody and preparation method thereof
  • Anti-humanized multidrug resistant protein Fab antibody and preparation method thereof
  • Anti-humanized multidrug resistant protein Fab antibody and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Cloning of P-gp transmembrane region gene sequence

[0038] 1. Design primers

[0039] Primers were designed with the following sequences:

[0040] Sense primer CCGGAATTCCTCACCAAGCGGCTCCGAT Anti-sense primer CCGCTCGAGGAGTTTATGTGCCACCAAGTAG

[0041] Upstream (5′ end) primer introduction Eco RI restriction site, downstream (3' end) primer introduction xho Ⅰ Restriction sites, synthetic primers.

[0042] 2. Cloning of P-gp transmembrane region (amino acid 784-968) gene sequence

[0043] (1) Extract total RNA from multidrug-resistant human colorectal cancer tissue and reverse transcribe it into cDNA:

[0044] 1) Prepare 10 cases of multidrug-resistant colorectal cancer tissues to make colorectal cancer tissue homogenate for immunization; take the colorectal cancer tissue homogenate for immunization and inject subcutaneously at multiple points to immunize BALB / C mice; if the antibody titer is greater than 1.512, it can be ;

[0045] 2) Extract...

Embodiment 2

[0065] P-gp 784-968 gene expression

[0066] (1) Take the correctly identified positive clone P-gp 784-968 Inoculate 10 μL of the bacterial solution into 5 mL LB / Kan liquid medium, shake and cultivate overnight at 37°C and 220 rpm;

[0067] (2) Take 200 μL of the overnight culture and re-inoculate it into 20 mL of new LB / Kan liquid medium, culture at 37°C and shake at 220 rpm for about 4 hours, measure the OD 600nm About 0.4, take the bacteria solution;

[0068] (3) Then add IPTG (100mmol / mL) to the culture bottle to make the final concentration 0.5mmol / mL, continue shaking culture at 30°C and 220rpm for 3 hours, and take the bacterial liquid;

[0069] (4) Centrifuge the bacterial solution collected before and 3 hours after induction with IPTG at 12,000 rpm for 1 minute, discard the supernatant, and add 100 μL of PBS (pH: 7.4) to resuspend. Take 30 μL of bacterial solution and add 6 μL of 6× protein loading buffer, boil at 100°C for 10 minutes;

[0070] (5) Take 30 μL of...

Embodiment 3

[0073] P-gp 784-968 Purification of expression products

[0074] (1) First, filter the lysate supernatant, triple-distilled water, Binding buffer, and each imidazole gradient Elute buffer with a 0.22 μm microporous filter; wash the nickel ion affinity chromatography column (Ni column) 5 volumes;

[0075] (2) Then the lysate supernatant flows through the nickel column at a flow rate of 1mL / min, washes 10 volumes of the nickel column with Binding buffer, and elutes the nickel column with Elute buffer with 50mM, 150mM, and 300mM imidazole concentrations respectively to obtain a purified sample , SDS-PAGE electrophoresis detection;

[0076] (3) P-gp 784-968 Dialysis and desalination of the purified sample: put the purified protein sample in a dialysis bag, close the dialysis bag and place it in PBS at 4°C for dialysis, replace the PBS every 12 hours, and continue dialysis for 36 hours, then take out the protein sample, Store at 4°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an anti-humanized multidrug resistant protein Fab antibody and a preparation method thereof, and belongs to the field of antibodies and preparation. The preparation method comprises the following steps: performing reverse transcription of general RNA of pathological tissue of colorectal cancer in multidrug resistance to cDNA; amplifying a P-gp transmembrane domain (amino acid 784-968) gene segment by a specific primer designed in a laboratory; cloning to a pET28a(+) carrier and converting E.coliBL21(DE3), IPTG; performing inducible expression at 30 DEG C; performing WesternBolt identification for an expression product purified by a nickel ion affinity column; using purified P-gp784-968 protein as an antigen, and using 17 heavy chain upstream primers and 5 heavy chain downstream primers; for 20 light chain upstream primers and 2 light chain downstream primers, elutriating a P-gpFab antibody library of a Comb3 carrier by P-gp784-968 peptide segment in prokaryotic expression for five rounds; and finally performing double digestion identification for clones obtained by elutriation and performing IPTG (Isopropyl-Beta-d-Thiogalactoside) inductive expression; and obtaining a positive clone strain after ELISA and WesernBlot identification from the expression product, and detecting the sequence to obtain PFab29. The invention lays foundation for preparing multidrug resistant drug for inhibiting tumors.

Description

technical field [0001] The invention belongs to the field of Fab antibody and its preparation, in particular to an anti-multidrug resistance protein Fab antibody and its preparation method. Background technique [0002] The multidrug resistance (MDR) of tumor cells is mostly acquired drug resistance, that is, they are sensitive to drugs before treatment and resistant to drugs after treatment. Multidrug resistance refers to not only resistance to the drugs used, but also cross-resistance to other drugs with completely different structures and mechanisms of action. The most important reason for the multidrug resistance of tumor cells is the overexpression of an ATP-dependent efflux pump in the tumor cell membrane to reduce the accumulation of chemotherapy drugs inside the cell. This ATP-dependent efflux pump belongs to the ABC (ATP-binding cassette) transporter superfamily, mainly including the following: (1) tumor multidrug resistance protein 1 / P-glycoprotein is P-gp (Multi ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/18C12N15/13A61K39/395A61P35/00
Inventor张学梅张海玉王清李俊
OwnerDALIAN UNIVERSITY