Dominant flora in white gourd cooked curing process and amplification primer thereof
A technology of dominant flora and dominant bacteria, applied in the direction of bacteria, microorganisms, and methods based on microorganisms, can solve the problems of blindness in the pickling process, and it is difficult to accurately understand the role of different microorganisms in the microbial population structure of wax gourd
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment 1
[0026] The invention relates to the dominant bacteria group in the process of ripening and pickling the wax gourd. In the early stage of the wax gourd, the dominant bacteria in the pickling system are Acinetobacter, Weissella and Bacillus; , the dominant bacteria were transformed into Weisseria, Bacillus and Enterobacter; in the mid-term of the wax gourd ripening, the dominant bacteria changed into Lactobacillus, Bacillus and Weisseria; In the later stage, the dominant bacteria were Weisseria, Bacillus and Staphylococcus. The specific process of determining the dominant flora is as follows:
[0027] 1. Cooked winter gourd
[0028] The pickling of winter gourd is carried out according to the traditional pickling process. After washing the fresh winter melon, weigh, peel and remove the seeds. Then cut into squares with a side length of about 8 cm, put them in boiling water and cook for 6-8 minutes, then remove. Soak the removed wax gourd in water for a day, and then add sa...
specific Embodiment 2
[0074] An amplification primer for the dominant flora in the process of ripening and pickling of wax gourd, the dominant bacteria is Leuconostoc enteroides, the upstream primer of the Leuconostoc enteroides is 5′-GCTCTGAAGTGATTTTATCTGACA-3′, and the downstream primer is 5 '-AACCATGCGGTTGTTGGTA-3'. The primers are designed to be distinguished from the dominant flora that appear in the process of ripening and pickling of wax gourd, such as Acinetobacter, Lactobacillus, Bacillus, Enterobacter or Staphylococcus bacteria; the primers are used to verify the test results Figure 5 It can be seen that the specificity of the upstream and downstream primers of Leuconostoc membranaceus is very strong, and it cannot amplify other dominant bacteria that appear in the process of ripening and pickling of wax gourd, such as Acinetobacter calcoaceticus (Acinetobacter genus) , Weisseria antophagus (Weisseria spp), Lactobacillus campylobacter (Lactobacillus spp.), Bacillus halidenitrificans (Bac...
specific Embodiment 3
[0109] An amplification primer for dominant bacteria in the process of ripening and pickling wax gourd, the dominant bacteria is Acinetobacter calcoaceticus, the upstream primer of Acinetobacter calcoaceticus is 5′- GGAGAGAGGTAGCTTGCTACTGATC -3′, and the downstream primer is 5′- AACTAAAGTAGCCTCCTCCTCGC - 3'. The primers were designed to be distinguished from the dominant flora that appeared in the process of ripening and marinating wax gourd, such as: Weisseria, Lactobacillus, Bacillus, Enterobacter or Staphylococcus bacteria; the primers were verified by the test result Image 6 It can be seen that the specificity of the upstream and downstream primers of Acinetobacter calcoaceticus is very strong, and it cannot amplify other dominant bacteria that appear in the process of ripening and pickling of wax gourd: such as Leuconostoc membranaceus (Weissella), Sinus esophagus Weisseria (Weisseria), Lactobacillus campylobacter (Lactobacillus), Bacillus halidenito (Bacillus), Enterob...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 