Dominant flora in white gourd cooked curing process and amplification primer thereof

A technology of dominant flora and dominant bacteria, applied in the direction of bacteria, microorganisms, and methods based on microorganisms, can solve the problems of blindness in the pickling process, and it is difficult to accurately understand the role of different microorganisms in the microbial population structure of wax gourd

Active Publication Date: 2015-04-15
乾生(宁波)科技有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the limitation and one-sidedness of the traditional pure culture technology to study microbial diversity, it is difficult to accurately understand the microbial population structure and the role of different microorganisms in the pickling process of wax gourd, which also brings blindness to the improvement of the pickling process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dominant flora in white gourd cooked curing process and amplification primer thereof
  • Dominant flora in white gourd cooked curing process and amplification primer thereof
  • Dominant flora in white gourd cooked curing process and amplification primer thereof

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0026] The invention relates to the dominant bacteria group in the process of ripening and pickling the wax gourd. In the early stage of the wax gourd, the dominant bacteria in the pickling system are Acinetobacter, Weissella and Bacillus; , the dominant bacteria were transformed into Weisseria, Bacillus and Enterobacter; in the mid-term of the wax gourd ripening, the dominant bacteria changed into Lactobacillus, Bacillus and Weisseria; In the later stage, the dominant bacteria were Weisseria, Bacillus and Staphylococcus. The specific process of determining the dominant flora is as follows:

[0027] 1. Cooked winter gourd

[0028] The pickling of winter gourd is carried out according to the traditional pickling process. After washing the fresh winter melon, weigh, peel and remove the seeds. Then cut into squares with a side length of about 8 cm, put them in boiling water and cook for 6-8 minutes, then remove. Soak the removed wax gourd in water for a day, and then add sa...

specific Embodiment 2

[0074] An amplification primer for the dominant flora in the process of ripening and pickling of wax gourd, the dominant bacteria is Leuconostoc enteroides, the upstream primer of the Leuconostoc enteroides is 5′-GCTCTGAAGTGATTTTATCTGACA-3′, and the downstream primer is 5 '-AACCATGCGGTTGTTGGTA-3'. The primers are designed to be distinguished from the dominant flora that appear in the process of ripening and pickling of wax gourd, such as Acinetobacter, Lactobacillus, Bacillus, Enterobacter or Staphylococcus bacteria; the primers are used to verify the test results Figure 5 It can be seen that the specificity of the upstream and downstream primers of Leuconostoc membranaceus is very strong, and it cannot amplify other dominant bacteria that appear in the process of ripening and pickling of wax gourd, such as Acinetobacter calcoaceticus (Acinetobacter genus) , Weisseria antophagus (Weisseria spp), Lactobacillus campylobacter (Lactobacillus spp.), Bacillus halidenitrificans (Bac...

specific Embodiment 3

[0109] An amplification primer for dominant bacteria in the process of ripening and pickling wax gourd, the dominant bacteria is Acinetobacter calcoaceticus, the upstream primer of Acinetobacter calcoaceticus is 5′- GGAGAGAGGTAGCTTGCTACTGATC -3′, and the downstream primer is 5′- AACTAAAGTAGCCTCCTCCTCGC - 3'. The primers were designed to be distinguished from the dominant flora that appeared in the process of ripening and marinating wax gourd, such as: Weisseria, Lactobacillus, Bacillus, Enterobacter or Staphylococcus bacteria; the primers were verified by the test result Image 6 It can be seen that the specificity of the upstream and downstream primers of Acinetobacter calcoaceticus is very strong, and it cannot amplify other dominant bacteria that appear in the process of ripening and pickling of wax gourd: such as Leuconostoc membranaceus (Weissella), Sinus esophagus Weisseria (Weisseria), Lactobacillus campylobacter (Lactobacillus), Bacillus halidenito (Bacillus), Enterob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses dominant flora in a white gourd cooked curing process and an amplification primer thereof. In the preliminary stage of white gourd cooked curing, dominant bacteria in the curing system include acinetobacter, Weissella and bacillus; in the early stage, the dominant bacteria include Weissella, bacillus and enterobacter; in the middle stage, the dominant bacteria include lactobacillus, bacillus and Weissella; in the later stage, the dominant bacteria include Weissella, bacillus and staphylococcus; the upstream and downstream primers of the similar leuconostoc mesenteroides are shown by SEQ ID No.1 and No.2; the upstream and downstream primers of acinetobacter calcoaceticus are shown by SEQ ID No.3 and No.4; the upstream and downstream primers of Weissella cibarium are shown by SEQ ID No.5 and No.6; and the upstream and downstream primers of lactobacillus curvatus are shown by SEQ ID No.7 and No.8. According to the invention, the dynamic change conditions of the dominant microorganisms in a white gourd fermentation process are revealed so as to provide theoretical basis to the technological improvement and quality control.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a dominant flora and an amplification primer thereof during the ripening and pickling process of wax gourd. Background technique [0002] Pickled wax gourd (that is, stinky wax gourd) is one of the traditional special pickled vegetables in eastern Zhejiang, with a long history. The stinky wax gourd has a stinky smell, but it is easy to enter and has a unique taste. It is very popular among people in Ningshao, Zhejiang and other areas. A great meal. The ripening of wax gourd is carried out according to the traditional ripening process. After cleaning the fresh wax gourd, it is weighed, peeled, and flesh removed. Then cut into squares with a side length of about 8cm, put them in boiling water and cook for 6-8 minutes, then remove them. Soak the removed wax gourd in water for a day, then add salt according to a certain proportion. When adding salt, smear the six sides of the wax gourd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/20C12N15/11C12Q1/68C12Q1/06C12R1/07C12R1/01C12R1/225C12R1/44
Inventor沈锡权赵永威吴祖芳翁佩芳
Owner乾生(宁波)科技有限公司