Method for improving protein soluble expression through rational translation pause sequence redesigning

A technology for translational pause sequences and proteins, which is applied in the field of improving protein soluble expression through rational redesign of translational pause sequences, and can solve the problems of protein misfolding and aggregation, slowness, and inability to obtain soluble proteins.

Active Publication Date: 2015-02-11
CHI BIOTECH CO LTD +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although different DNA can be translated into the same amino acid, the speed of protein production (translation speed) is not constant, and it will be slower in some segments. This phenomenon is called translation pause (translational pause or translational attenuation) translation pause The point is highly related to protein folding. If the translation pause site is incorrect, the slow place is fast, or the fast place is slow, it will lead to misfolding and aggregation of proteins, and it is impossible to obtain functional soluble proteins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving protein soluble expression through rational translation pause sequence redesigning
  • Method for improving protein soluble expression through rational translation pause sequence redesigning
  • Method for improving protein soluble expression through rational translation pause sequence redesigning

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1 CVN codon optimization and expression vector construction

[0071] Using the translation pause theory, optimize the nucleotide sequence encoding CVN protein, rationally design the translation pause site, and carry out synonymous mutations on the nucleotide sequence of CVN by mutation PCR technology.

[0072] The coding nucleotide sequence of CVN protein is as follows:

[0073] CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTGGACGACCACATCGCTAACATAGACGGTACACTAAAATACGAA。

[0074] (1) Design the nucleotide sequence encoding the CVN mutant by translation pause theory:

[0075] 1) According to the protein structure, determine where the translation pause site should exist

[0076] ① For multi-domain proteins, the translation pause site is designed within: A...

Embodiment 2

[0112] (1) Preparation of expression strains:

[0113] ① Preparation of Escherichia coli BL21 (DE3) competent cells: For the preparation process, refer to the third edition of "Molecular Cloning Experiment Guide"; [US] J. Sambrook, translated by Huang Peitang.

[0114] ②Transform the expression vectors pET-28b-CVN, pET-28b-CVN-M1 and pET-28b-CVN-M2 into Escherichia coli BL21 (DE3) competent cells: see the third part of "Molecular Cloning Experiment Guide" for details on the transformation process. Edition; [US] J. Sambrook, translated by Huang Peitang.

[0115] (2) Induced expression and solubility analysis of CVN and its mutants

[0116] ① Inoculate the expression strains CVN-BL21, CVN-M1-BL21 and CVN-M2-BL21 obtained in step (1) into 20 mL of LB medium containing 50 μg / mL kanamycin content, culture at 37 °C and 180 rpm, When OD 600 When = 0.8, add IPTG, the final concentration is 1mM, after induction expression at 37℃ for 4h, measure the OD 600 , to ensure the volume of ...

Embodiment 3

[0123] Study on Anti-Influenza Virus A / HK / 8 / 68(H3N2) Activity of CVN

[0124] Dog kidney epithelial cells MDCK cells (ATCC, USA) were digested with 0.25% trypsin solution by weight and volume, and then mixed with 2.5×10 5 Add the cells / well into a 96-well cell culture plate (MEM medium, containing 10% calf serum by volume), discard the growth medium after the cells grow into a monolayer, and use the maintenance medium (MEM medium, without calf serum ) respectively prepare the drug CVN protein (preserved in the laboratory and can be prepared according to the steps disclosed in the publication number CN101638435 and titled "A Mutant of Cyanobacterial Virus Protein N, Its Modified Derivatives and Its Application") and Example 2. CVN mutant protein was diluted into 6 serial concentrations (100, 50, 25, 12.5, 6.25, 3.125 μM), and 3 replicate wells were set up for each dilution, and a normal cell control group was set at the same time, positive drug (ribavirin) Control group, 37℃, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses a method for improving protein soluble expression through rational translation pause sequence redesigning. The method comprises the following steps: according to a protein structure, determining an existing position of a translation pause site; carrying out mutation of a slow translation codon outside a translation pause range into a high frequency codon having the same amino acids; and carrying out same sense mutation in the translation pause range according to selection of 2-6 codons, and producing the translation pause site. According to the method, on the premise of no change of the protein amino acid sequence, a nucleotide sequence for encoding protein is redesigned so as to enhance soluble expression efficiency. In addition, the method has characteristics of wide applicability and great prospect potential.

Description

technical field [0001] The invention relates to a protein expression optimization method, in particular to a method for improving protein soluble expression through rational redesign of translation pause sequence. Background technique [0002] In protein engineering, people clone genes into host expression systems (such as bacteria or eukaryotic cell lines) and induce their expression to produce the desired protein. However, heterologous genes often cannot be well expressed when cloned into host cells, the yield is very low, or the inclusion body does not function normally, and the reason is that there is a problem with protein folding in most cases. [0003] To solve the problem of protein misfolding in heterologous expression, one of the traditional ideas is inclusion body refolding, that is, using a strong denaturant to dissolve and denature the inclusion body, and then remove the denaturant under controlled conditions, in order to refold the protein under suitable soluti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C12N15/31C12N15/70C12R1/01
Inventor 张弓陈伟熊盛金静洁
Owner CHI BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap