A sleep peptide fusion protein and its application

A technology of fusion protein and sleep peptide, which is applied in the field of sleep peptide fusion protein and its application, can solve the problems of difficulty in industrialization, high industrial cost of fusion protein, and difficulty in purification of small molecule proteins, and achieves the advantages of purification and simple purification steps High efficiency, reduced dosing frequency and dose effect

Inactive Publication Date: 2016-08-24
LANZHOU UNIVERSITY OF TECHNOLOGY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The maturity of bioengineering technology has made the expression of PHD/PHLD in different engineering bacteria without technical obstacles, which is not difficult to find from the reports on its successful expression in different engineering bacteria in domestic and foreign literature, but as a small mol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A sleep peptide fusion protein and its application
  • A sleep peptide fusion protein and its application
  • A sleep peptide fusion protein and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Cloning construction of HSA cDNA:

[0032] For the extracted human liver tissue mRNA, put 100mg of human liver tissue directly into a mortar, add a little liquid nitrogen, and grind quickly. After the tissue becomes soft, add a small amount of liquid nitrogen, and grind again. into a centrifuge tube and let stand at room temperature for 5 min. Centrifuge at 4°C (12000g) for 10min, and take the supernatant. Add 0.2ml of chloroform, close the cap of the centrifuge tube tightly, shake vigorously by hand for 15s, then place in ice bath for 15min, centrifuge at 4°C (12000g) for 15min, and store the RNA in the upper aqueous phase. Transfer the aqueous phase to another clean centrifuge tube, add 0.5ml of isopropanol, mix well, leave at room temperature for 10min to precipitate RNA, and then centrifuge at 4°C (12000g) for 10min. Remove the supernatant, add 1ml of 75% ethanol to wash the precipitate, vortex, and then centrifuge at 4°C (7500g) for 5min to recover ...

Embodiment 2

[0037] Example 2: Construction of PTD-HAS-DSIP (PHD) target gene:

[0038] Using the plasmid obtained in Example 1 as a template, the primers can be

[0039] P: 5'-GAATTCTACGGTCGTAAGAAAAGAAGACAACGTAGACGTGATGC

[0040] ACACAAGAGTGAG-3’

[0041] Under P: 5'- GCGGCCGCTTATTCTCCAGAAGCATCACCACCAGCCATAAGCCT

[0042] AAGGCAGCTTG-3'

[0043] The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The PCR method is as follows: add 2 μl of pPIC9K / H-T recombinant plasmid to 100 μl reaction system, 3 μl of 20 μmol / L upper and lower P primers, 2 mmol / L dNTP, 10 μl, 10 μl of 10× reaction buffer, pfu DNA polymerase 5U, (dNTP, reaction buffer, and pfu DNA polymerase are all products of Takara Company). The PCR conditions were denaturation at 94°C for 30 seconds, annealing at 50°C for 30 seconds, extension at 72°C for 3 minutes, and 30 cycles. The reaction product was analyzed by gel electrophoresis, and a band of expected size (about 2kb) was displayed. The PCR product PH...

Embodiment 3

[0049] Embodiment 3: PTD-HAS-(Gly 4 Ser) 3 – Construction of DSIP (PHLD) target gene:

[0050] Using the plasmid obtained in Example 1 as a template, the primers can be

[0051] P: 5'-GAATTCTACGGTCGTAAGAAAAGAAGACAACGTAGACGTGATG

[0052] CACACAAGAGTGAG-3'

[0053] Lower P: 5'-GCGGCCGCTTATTCTCCAGAAGCATCACCACCAGCCCAAGAACC

[0054] TCCACCAGAACCTCCACCAGAACCTCCACCTAAGCCTAAGGCAGCTTG-3’

[0055] The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. For PCR amplification, see Example 2 for the specific operation method.

[0056] For the gene sequence, please refer to SEQ ID NO: 2 in the description of the accompanying drawings. See the appendix for the plasmid construction process figure 2 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A sleep peptide fusion protein and application thereof, comprising a first region homologous to SEQ ID No: 1 serum albumin or at least 85% sequence homologous to serum albumin in the sequence table, and a sequence connected to the C-terminus of serum albumin The sleep peptide of SEQ ID No:2 in the list or the second region with at least 85% sequence homology of the sleep peptide, and the conductive peptide of SEQ ID No:3 in the sequence listing connected to the N-terminal of serum albumin or at least with the conductive peptide The third region with 85% sequence homology, the sleep peptide fusion protein can be formed by connecting the first region, the second region and the third region at the same time, or it can be composed of the first region, the second region and the third region The three regions are connected simultaneously, and the first region and the second region are formed by linking peptides; the application in the treatment of sleep disorders and insomnia.

Description

technical field [0001] The invention relates to the preparation and application of a novel long-acting PHD / PHLD fusion protein synthesized by genetic engineering technology, including a recombinant vector containing the gene and a Pichia host transformed with the vector. Background technique [0002] Insomnia is a common disease. In today's fast-paced society and intensified competition, insomnia has become a very common phenomenon. According to the research data of Professor Pan Jiyang in China, the current prevalence of insomnia in Chinese families is as high as 10% to 20%. Therefore, the development of effective and safe anti-insomnia drugs has become an urgent medical and social problem. [0003] Clinically, chemically synthesized drugs with sedative and hypnotic effects are commonly used to treat insomnia. Currently, the second-generation benzodiazepines and the third-generation non-benzodiazepine hypnotic drugs are commonly used clinically. These drugs all exist in v...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00A61K38/17A61K47/48A61P25/20
Inventor 张新国张春生李坤
Owner LANZHOU UNIVERSITY OF TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap