Diamondback moth cecropin 3, preparation method and application thereof

A technology of cecropin and diamondback moth, applied in the field of genetic engineering, can solve the problems of inactivity, toxicity and very sensitive protease of antimicrobial peptides, and achieve the effect of strong inhibitory effect

Active Publication Date: 2014-01-01
SOUTH CHINA AGRI UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented method allows for studying how certain types of insect called Diamonds Back Lyme (DBL) are able to fight against harmful microorganisms like those causing diseases such as yellow mold or rust disease that affect crops worldwide. By analyzing this DNA sequences from DBLIB2 gene coding it can identify specific proteins involved in defense mechanisms which may help create novel compounds useful for medicine purposes.

Problems solved by technology

Technologies described include finding ways to creatively design antimyclicpeptid compounds called neoantigene sppamists, which target specific types of DNA sequences like those involved in various life processes including defense mechanisms. These techniques aim to provide novel antitumor agents without causing side effects caused by existing chemotherapy or immunoplasma therapies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diamondback moth cecropin 3, preparation method and application thereof
  • Diamondback moth cecropin 3, preparation method and application thereof
  • Diamondback moth cecropin 3, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Cloning of the cecropin 3 gene of diamondback moth

[0031] S1. Raising diamondback moth in the laboratory ( Plutella xylostella ) larvae, with E. coli ( Escherichia coli ) and Staphylococcus aureus as the tested strains.

[0032] S2. Determination of the transcriptome sequence of Plutella xylostella: Collect the 1st to 4th instar larvae, prepupa, pupae, and adults of Plutella xylostella, extract the total RNA, and use RNA-seq technology to determine the transcriptome sequence. The extraction method of total RNA refers to Trizol (Invitrogen, USA) kit manual operation. A total of 34,522,812 clean reads were detected, the average length of the reads was 90bp, and 3,107,053,080 bases were obtained. Finally, 107710 Unigenes were assembled, with a length ranging from 200 to 3000 bp. After COG, GO, KEGG annotation and analysis, a total of 68,984 Unigenes with high annotation reliability were obtained, and 725 Unigenes directly related to insect immunity, i...

Embodiment 2

[0061]Example 2 The method for preparing cecropin 3 from Plutella xylostella with bactericidal function

[0062] S1. Microorganisms required in the experiment, Gram-negative bacteria: Pseudomonas fluorescens ( Pseudomonas fluorescent ), Salmonella choleraesuis ( Salmonella cholerae suis ) and Escherichia coli ( Escherichia coli K 12 D. 31 ). Gram-positive bacteria: Staphylococcus aureus ( Staphylococcus aureus ), Bacillus cereus ( Bacillus cereus ). Fungi: Botrytis cinerea ( Botrytis cinerea ), Penicillium ( Penicillium crustosum ), Phytophthora lychee ( Peronophythora litchi ), Litchi anthracnose ( Colletotrichumgloeos porioiees Penz. ), Fusarium oxysporum ( Fusarium oxysporum ) and Melon Anthracnose ( Colletotrichum orbicucar ) as the tested strain.

[0063] S2. Primers for amplifying the mature peptide of Plutella xylostella cecropin 3:

[0064] MF: GCG CCATGG CCAGGTGGAAAGGCTTTAAG, CCATGG Indicates that the introduced enzyme cleavage...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses diamondback moth cecropin 3, a preparation method and an application thereof, wherein the diamondback moth cecropin 3 gene has a nucleotide sequence represented by SEQIDNO:1-2 and has a corresponding amino acid sequence represented by SEQIDNO:3, and sequence analysis results show that the mature peptide of the diamondback moth cecropin 3 has an amino acid sequence represented by SEQIDNO:4. According to the present invention, the diamondback moth cecropin 3 gene or the mature peptide sequence thereof is subjected to prokaryotic expression to obtain the diamondback moth cecropin 3, and the obtained diamondback moth cecropin 3 provides strong inhibition effects for gram-negative bacteria and gram-positive bacteria, provides strong inhibition effects for pathogenic fungi, especially provides strong inhibition effects for a lot of pathogenic fungi of melons and fruits, and is expected to be a novel peptide antibiotic.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products