Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene

A gene and nucleic acid technology, applied in the field of detecting codons 12 and 13 of a K-ras gene and its related products, can solve the problems of high cost, long time, cumbersome steps, etc., achieve high accuracy, high sensitivity, reduce The effect of the cost of consumables

Active Publication Date: 2014-03-26
BIOYONG TECH
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing detection techniques either have cumbersome steps...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene
  • Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene
  • Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1, primer design.

[0082] For the K-ras gene DNA fragment, design corresponding specific PCR primer core sequences (SEQ ID No: 1 and SEQ ID No: 2), the pair of primers can amplify the K-ras gene coding sequence, including 12 and 13 codons 83bp within.

[0083] SEQ ID No: 1: 5'-AAGGCCTGCTGAAAATGACTG-3'

[0084] SEQ ID No: 2: 5'-TAGCTGTATCGTCAAGGCACTCT-3'

[0085] Their amplified sequence SEQ ID NO:3 (83bp) is as follows (the underlined region is codons 12 and 13, and only the wild type is listed):

[0086] SEQ ID No: 3: AAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCT G GTGGC GTAGGCAAGAGTGCCTTGACGATACAGCTA

[0087] In order to allow reverse transcriptase to recognize PCR products and prevent PCR primers from entering the detection window of the mass spectrometer and interfering with the detection effect, it is also necessary to add specific sequences (lowercase letters) to the 5' ends of SEQ ID No: 1 and SEQ ID No: 2. Therefore, the actually synthesized...

Embodiment 2

[0093] Embodiment 2, sample preparation.

[0094] Through molecular cloning techniques such as plasmid construction and site-directed mutagenesis, a total of 8 plasmids containing K-ras gene wild type and 7 kinds of mutations were constructed, respectively samples WT (wild type), 12A (12 codons GGT>GCT) , 12C (12 codon GGT>TGT), 12D (12 codon GGT>GAT), 12R (12 codon GGT>CGT), 12S (12 codon GGT>AGT), 12V (12 codon GGT>GTT) , 13D (13 codon GGC>GAC). This operation adopts the basic techniques commonly used in molecular biology and will not be repeated here.

[0095] Clinical colorectal cancer patient 1, when the tumor tissue was surgically removed, a fresh tissue block (soybean size) was taken, and the patient's tumor was extracted with a blood / cell / tissue genome extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) Genomic DNA, designated as sample 1, was reserved at -20°C.

[0096] For patient 2 after colorectal cancer surgery, venous blood was collect...

Embodiment 3

[0099] Example 3. Difference analysis and verification of nuclease digestion fingerprints of wild-type and mutant nuclease-cut fingerprints of codons 12 and 13 of K-ras gene.

[0100] By theoretically analyzing the sequences of the wild type and the mutant type, the wild type and the mutant type will produce different nuclease digestion fingerprints, as shown in Table 2, the DNA fragment of the wild type will produce a peak of 3738.35 by enzyme digestion, and no It has peaks such as 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37, while the mutant DNA fragment is just the opposite. After digestion and mass spectrometry, one or several of the peaks such as 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37 will be produced, instead of There is a 3738.35 peak. Therefore, in theory, the existence of the wild type can be determined by the presence of the 3738.35 peak, and the presence of the mutant type can be determined by the presence or absence of one or several of the peaks such as...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting mutation of codons 12 and 13 of a K-ras gene. The method is based on a mass spectrometric detection nuclease cleavage fingerprint technology and comprises the steps of PCR (Polymerase Chain Reaction) amplification, PCR product purification, reverse transcription, nuclease cleavage, nuclease cleavage product purification, mass spectrometer detection and the like. To detect whether the codons 12 and 13 of the K-ras gene mutate based on the method can provide a reference for clinic judgment of patient prognosis and determination of a dosage schedule.

Description

technical field [0001] The invention belongs to the field of gene detection, and relates to a preparation method of nucleic acid mass spectrometry for detecting colorectal cancer K-ras gene mutations and products thereof, in particular to detecting a kind of K-ras gene 12, 13 codons and their related products. Background technique [0002] K-ras gene (GenBank: NC_000012) is a proto-oncogene in the RAS gene superfamily. It is located on the short arm of chromosome 12. The protein encoded by it is an important protein in the signal transduction pathway of cell surface receptors such as EGFR. It plays a key role in the occurrence and development of tumors. Participate in cell cycle regulation through downstream signaling proteins, and are closely related to tumor cell survival, proliferation, migration and diffusion, and angiogenesis. [0003] Under normal physiological conditions, cells are stimulated by the outside world and activate EGFR and other signaling pathways. The w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q1/6886C12Q2600/106C12Q2600/156C12Q2565/627
Inventor张学记马庆伟赵洪斌张海燕林燕
OwnerBIOYONG TECH