Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

CSRP2 gene for regulating development of arterial smooth muscle of small tailed han sheep and application thereof

A small-tailed Han sheep and smooth muscle technology, applied in the field of molecular biology, can solve the problems of unknown regulation of the growth and development of vascular smooth muscle, no research report on the cloning and function of the small-tailed Han sheep CSRP2 gene, etc., and has broad application prospects. Effect

Inactive Publication Date: 2015-01-28
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] But so far, there have been no research reports on the cloning and function of the CSRP2 gene in Small-tailed Han sheep, and its role in regulating the growth and development of vascular smooth muscle is still unknown.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CSRP2 gene for regulating development of arterial smooth muscle of small tailed han sheep and application thereof
  • CSRP2 gene for regulating development of arterial smooth muscle of small tailed han sheep and application thereof
  • CSRP2 gene for regulating development of arterial smooth muscle of small tailed han sheep and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Extraction and reverse transcription of aortic total RNA

[0044] Take 2 g of the aorta of Small Tail Han sheep, and use the RNAsimple Total RNA Kit total RNA extraction kit (Cat.#DP419) from TIANGEN Company to extract the total RNA of the aortic tissue. RrimeScript TM RT reagent Kit (Cat.#RR037A) was reverse transcribed to synthesize the first strand of cDNA, and stored at -20°C for future use.

Embodiment 2

[0045] Example 2: Cloning and sequencing of cDNA conserved region sequences

[0046] (1) Design of primers: Download the cDNA sequences of CSRP2 genes of various species such as human, pig, cow, and mouse from NCBI, and compare them with DNAMAN 6.0 software to obtain the sequence of the conserved region, and design two pairs of primers for the conserved region of the cDNA of the gene as follows: :

[0047]Upstream primer F1: GCCGACAACAAATCCAAAC, as shown in SEQ ID NO.3;

[0048] Upstream primer F2: TTGAGATGCCTGTCTGGG, as shown in SEQ ID NO.4;

[0049] Downstream primer R1: TCAGCCAGCCTATCCAAGT, as shown in SEQ ID NO.5;

[0050] Downstream primer R2: CTTTCTCGGTTCTGGGTTT, as shown in SEQ ID NO.6.

[0051] (2) PCR amplification: using the first strand of cDNA obtained in Example 1 as a template, the PCR Master Mix (KT201) system of TIANGEN was used to carry out PCR amplification, as follows:

[0052]

[0053] The first primer for the conserved region fragment is F1, the rev...

Embodiment 3

[0060] Example 3: Cloning and sequencing of cDNA 3' end sequence

[0061] The 3' end of the cDNA sequence was cloned by landing nested PCR method, and the specific steps were as follows:

[0062] (1) Design and synthesis of primers: According to the sequencing results of the cDNA conserved region of the CSRP2 gene obtained in Example 2, two upstream nested primers were designed, 3'GSP: GTTTCCGATGTGCTAAGTG, as shown in SEQ ID NO.7,

[0063] and 3'NGSP: ATAGGTAATCTAACACTCAAC, as shown in SEQ ID NO.8;

[0064] And synthesize two downstream 3' universal primers, 3'-UP: GACTCGAGTCGATCGA, as shown in SEQ ID NO.9,

[0065] and OligodT-AP: GACTCGAGTCGATCGATTTTTTTTTTTTTTTTTT, as shown in SEQ ID NO.10;

[0066] (2) Synthesis of the first strand of cDNA by reverse transcription: take 4 μl of the total RNA extracted in Example 1, use the reverse transcription kit in Example 1, and add OligodT-AP as the reverse transcription primer to synthesize the first strand of cDNA by reverse transc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biotechnical field and particularly relates to a cDNA sequence of a CSRP2 gene for regulating development of an arterial smooth muscle of small tailed han sheep and a cloning method thereof. The cDNA sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the cDNA sequence is shown in SEQ ID NO.2. By regulating the expression of the SCRP2 gene, the gene can be used for recombinant expression to produce a protein, so that a scientific basis is provided for researching molecular medicines of vascular diseases of sheep and other mammals, and the gene has a wide prospect for treating artery injury of sheep and detecting cardiovascular diseases.

Description

technical field [0001] The invention belongs to the field of molecular biology. Specifically, the invention relates to a CSRP2 gene capable of regulating the development of small-tailed Han sheep arterial smooth muscle and its application in the treatment of sheep diseases. Background technique [0002] With the continuous improvement of living standards, people's dietary structure has undergone new changes, and mutton is increasingly favored, thereby promoting the large-scale development of the sheep industry. The hazards of sheep diseases have brought great losses to the sheep industry. From molecular biology From a scientific point of view, more and more attention has been paid to the method of treating sheep diseases. [0003] CRP family is a kind of protein family in LIM domain protein, and four members are CRP1, CRP2, CRP3, TLP (Weiskirchen et al., 1995; Kirchner et al., 2001), among which the coding gene of CRP2 protein CSRP2( Cysteine ​​and glycine-rich protein2) is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12A61P9/00
Inventor 王建民刘冠卿张春兰王桂芝纪志宾侯磊
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com