A nano-gold based molecular beacon and its preparation and application

A molecular beacon and nano-gold technology are applied in the fields of multicolor molecular beacons and their preparation and application, which can solve the problems of poor specificity and low efficiency, and achieve the effects of simple method, maintaining stem-loop structure and improving hybridization efficiency.

Inactive Publication Date: 2017-03-01
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using miRNA as a template to ligate the probe to form a loop has poor specificity and low efficiency, and it needs to be separated by electrophoresis and detected by radioactive isotopes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nano-gold based molecular beacon and its preparation and application
  • A nano-gold based molecular beacon and its preparation and application
  • A nano-gold based molecular beacon and its preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] (1) Materials and equipment

[0076] Chlorauric acid (HAuCl4 4H2O, 99.99%), trisodium citrate, phosphate, NaCl, MgCl2, KCl, Milli-Q water; transmission electron microscope (TEM), UV spectrophotometer (Hitachi U-3010), fluorescence Spectrophotometer (F-4500, Hitachi), PH meter, refrigerated high-speed centrifuge (Hitachi); molecular beacons were purchased from Sangon Bioengineering (Shanghai) Co., Ltd. and purified using high performance liquid chromatography, target molecules (miRNA) Purchased from Yingwei Jieji (Shanghai) Trading Co., Ltd.

[0077] (2) Preparation and characterization of gold nanoparticles (AuNPs)

[0078] Nano gold (AuNPs) can be prepared with reference to the methods described in the following documents, references:

[0079] K.C. Grabar, R.G. Freeman, M.B. Hommer, M.J. Natan, Analytical

[0080] Chemistry 1995, 67, 735.

[0081] That is, gold nanoparticles were synthesized by a citric acid reduction method. The basic steps are as follows: add 1 ...

Embodiment 2

[0084] The molecular beacon for miR155 was originally designed, the ring region of the molecular beacon can specifically bind to miR155, the 5' end of the molecular beacon is connected to the FAM fluorescent group, and the 3' end is connected to PolyA10 (that is, 10 consecutive A base). In order to allow the molecular beacon to form a secondary stem-loop structure, the fluorescent probe has a certain distance from the surface of gold nanoparticles, so that its conformation remains upright to facilitate hybridization. Consecutive T bases.

[0085] A fluorescent probe with 5 consecutive T bases and PolyA10 connected to the 3' end

[0086] 5’-FAM- CGCTGC ACCCCTATCACGATTAGCATTAA GCAGCG TTTTTAAAAAAAAAAA-3' (100uM, 1.8uL) was co-assembled with AuNPs (3nM, 200uL) and incubated for 16h. Add 22ul of salt (1M NaCl, 100mM PB) and incubate for 24h. Centrifuge and wash (0.1M PBS).

[0087] The final molecular beacon is:

[0088] 5’-FAM- CGCTGC ACCCCTATCACGATTAGCATTAA GCAGCG TTT...

Embodiment 3

[0091] (1) Then use other methods to design a molecular beacon against miR155, the ring region of the molecular beacon can specifically bind to miR155, the 5' end of the molecular beacon is connected to a FAM fluorescent group, and the 3' end is connected to PolyA10 (also That is, 10 consecutive A bases) or PolyA20 (ie, 20 consecutive A bases). Direct connection between PolyA10, PolyA20 and the 3' end of the fluorescent probe without T base.

[0092] A fluorescent probe that connects the 3' end to PolyA10

[0093] 5’-FAM- CGCTGC ACCCCTATCACGATTAGCATTAA GCAGCG AAAAAAAAAAA-3' (100uM, 1.8uL) was co-assembled with AuNPs (3nM, 200uL) and incubated for 16h. Add salt (1M NaCl, 100mM PB) 22ul, and incubate for 24h. Centrifuge and wash (0.1M PBS).

[0094] The final molecular beacon is:

[0095] 5’-FAM- CGCTGC ACCCCTATCACGATTAGCATTAA GCAGCG AAAAAAAAAAA-Au-3' (SEQ ID NO.2), denoted as Molecular Beacon 3-1.

[0096] A fluorescent probe that connects the 3' end to PolyA20

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biotechnologies, in particular to a nanogold-based molecular beacon and its preparation and application. The nanogold-based molecular beacon comprises a fluorescent group, a first beacon stem area, a circular area, a second beacon stem area and nanogold. The circular area a nucleotide fragment in specific bond with a target molecule to be measured; a nucleotide sequence of the first beacon stem area and that of the second beacon stem area are complementary. The nanogold is connected with fluorescent probes through PolyA; thus, the defects of the traditional sulphydryl connection, complexity in synthesis and high cost, are avoided. A PolyA connection method is simple, the number of the probes on the surface of the nanogold is controllable, the probes can be kept vertical, and mixing of following molecular beacons and the target molecule to be measured is facilitated.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nano-gold-based multicolor molecular beacon and its preparation and application. Background technique [0002] In 1996, Tyagi and Kramer reported a new type of fluorescent nucleic acid probe with hairpin structure - molecular beacon (molecular beacon), the original purpose was to quantitatively measure the amount of the target in the liquid phase. The molecular beacon in the free state has a hairpin structure. At this time, the fluorescence is quenched due to the close proximity of the fluorescent group and the quenching group; when combined with the target sequence, the spatial configuration of the molecular beacon changes, and the fluorescence recover. Molecular beacon technology is not only widely used in biological research, but also in disease gene detection and diagnosis due to its simple operation, high sensitivity, strong specificity, real-time quantitative determination o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
CPCC12Q1/68C12Q1/6876C12Q2563/155C12Q2561/101
Inventor宓现强王晨光张欢曾冬冬
OwnerSHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI