Chimeric antigen receptor hCD19scFv-CD8a-CD-28-CD3zata and application thereof

A-CD28-CD3, hcd19scfv-cd8 technology, applied in the field of tumor cell immunotherapy, can solve the problem that the immune system cannot clear the tumor well

Active Publication Date: 2015-07-22
JUVENTAS CELL THERAPY LTD
View PDF2 Cites 113 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Tumor cells produce immune escape by down-regulating the expression of molecules involved in T cell recognition and antigen response, reducing immunogenicity, etc., so that the body's immune system cannot clear the tumor well

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor hCD19scFv-CD8a-CD-28-CD3zata and application thereof
  • Chimeric antigen receptor hCD19scFv-CD8a-CD-28-CD3zata and application thereof
  • Chimeric antigen receptor hCD19scFv-CD8a-CD-28-CD3zata and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Determination of hCD19scFv-CD8α-CD28-CD3ζ gene sequence

[0031] 1.1 The human CD8α signal peptide gene, human CD8α hinge region gene, human CD28 transmembrane region and intracellular region gene, and human CD3ζ intracellular region gene sequence. The anti-CD19 single-chain antibody (anti-CD19scFv) gene sequence comes from a patent (patent number: ZL200610015650.9), and its codons are optimized to ensure that it is more suitable for human cell expression without changing the encoded amino acid sequence.

[0032] For the sequence information of each gene, see SEQUENCE LISTING (SEQ ID NO.1-8 in the sequence listing).

[0033] 1.2 The above gene sequences were sequentially linked according to the human CD8α signal peptide gene, anti-CD19 scFv, human CD8α hinge region gene, human CD28 transmembrane region and intracellular region gene, and human CD3ζ intracellular region gene sequence, and introduced Kozac sequence, and introduce different restriction sites at...

Embodiment 2

[0034] Example 2: Construction of hCD19scFv-CD8α-CD28-CD3ζ expression plasmid

[0035] 2.1 Whole gene synthesis:

[0036] The complete hCD19-CAR sequence optimized by whole gene synthesis was cloned into the pCDH-EF1-MCS-T2A-copGFP lentiviral expression vector (pCDH-empty vector) to obtain the anti-human CD19-CAR expression plasmid (pCDH-CAR plasmid) and the DH5α bacterial fluid containing the plasmid. Plasmid information see figure 1 .

[0037] 2.2 Sequencing of recombinant plasmids:

[0038]The recombinant plasmid was sent to Shanghai Yingjun Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared with the fitted hCD19-CAR sequence to confirm that the sequence was correct. The sequencing primers are the universal sequencing primers on the pCDH-EF1-MCS-T2A-copGFP vector:

[0039] Sense: 5'ctccacgctttgcctgaccctgctt 3'

[0040] Anti-sense: 5'ggtgatgcggcactcgatctccatg 3'

[0041] For some sequencing results, see figure 2 .

Embodiment 3

[0042] Example 3: Large-scale extraction of target plasmids and packaging plasmids

[0043] The strains of pCDH-CAR plasmid, pCDH-empty vector plasmid, and psPAX2 and pMD2.G packaging plasmids were cultured in LB culture medium in large quantities, and a large number of plasmids were extracted by alkaline lysis method (Beijing Tiangen Biochemical Technology Co., Ltd. endotoxin-free plasmid extraction kit) for transfection.

[0044] 1) Add the bacterial solution to 150-200ml LB culture medium containing Amp at a ratio of 1:1000, and shake at 200rpm in a constant temperature incubator at 37°C for 12-16h;

[0045] 2) Take a small amount of bacterial liquid to test A 600 value, take it out after reaching about 0.4;

[0046] 3) Add 2.5ml of balance solution BL to the adsorption column CP5, centrifuge at 10,000rpm for 2min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube for later use.

[0047] 4) Centrifuge the bacteri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chimeric antigen receptor hCD19scFv-CD8a-CD-28-CD3zata and application thereof. The chimeric antigen receptor is serially connected by an anti-human CD19 monoclonal antibody H119a light chain and heavy chain variable region (hCD19scFv), human CD8a hinge region, a human CD28 transmembrane region, an intracellular region and a human CD3zata intracellular region. The chimeric antigen receptor is used for modifying T lymphocyte, and the modified T lymphocyte (CAR-T cell) can be used for treating the tumor with positive surface CD19.

Description

technical field [0001] The invention relates to the field of tumor cell immunotherapy. Using genetic engineering technology to obtain the fusion gene encoding the chimeric antigen receptor hCD19scFv-CD8α-CD28-CD3ζ, insert the gene fragment into a lentiviral expression vector, package it into a lentivirus, infect human T cells, and make the T cells express the chimeric antigen receptor. The chimeric antigen receptor T cells can recognize CD19 on the surface of tumor cells, specifically kill CD19-positive tumor cells, and are used for tumor treatment. Background technique [0002] The immune response mediated by tumor-specific T cells is the main means for the body to eliminate tumor cells. In a normal immune response, antigen-specific T cells need to be stimulated by at least two signals to proliferate and generate an immune response to the antigen. The first signal is the recognition of tumor-specific antigens by T cell receptor (TCR) and MHC-I or II molecules, and the sec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62A61K35/17A61P35/00
Inventor王建祥王敏安娜饶青廖小龙邢海燕
OwnerJUVENTAS CELL THERAPY LTD