163 results about "CD28" patented technology

Provided herein are trispecific and / or trivalent binding proteins comprising four polypeptide chains that form three antigen binding sites that specifically bind one or more target proteins, wherein a first pair of polypeptides forming the binding protein possess dual variable domains having a cross-over orientation, and wherein and a second pair of polypeptides possess a single variable domain forming a single antigen binding site. In some embodiments, the binding proteins comprise a binding site that binds a CD28 polypeptide, a binding site that binds a CD3 polypeptide, and a binding site that binds a third polypeptide, such as a tumor target protein. In some embodiments, the binding proteins comprise four polypeptide chains that form three antigen binding sites that specifically bind one or more HIV target proteins. The disclosure also relates to methods for making trispecific and / or trivalent binding proteins and uses of such binding proteins.

The present disclosure relates to anti-CD28 antibodies that bind to human CD28 and antigen-binding fragments thereof, compositions comprising same, and uses thereof in delaying and / or preventing tumor growth.

Provided herein are trispecific and / or trivalent binding proteins comprising four polypeptide chains that form three antigen binding sites that specifically bind one or more target proteins, wherein a first pair of polypeptides forming the binding protein possess dual variable domains having a cross-over orientation, and wherein and a second pair of polypeptides possess a single variable domain forming a single antigen binding site. In some embodiments, the binding proteins comprise a binding site that binds a CD28 polypeptide, a binding site that binds a CD3 polypeptide, and a binding site that binds a third polypeptide, such as a tumor target protein. In some embodiments, the binding proteins comprise four polypeptide chains that form three antigen binding sites that specifically bind one or more HIV target proteins. The disclosure also relates to methods for making trispecific and / or trivalent binding proteins and uses of such binding proteins.

The application provides guidance and navigation control (GNC) proteins. In one embodiment, the GNC protein Comprises a T-cell binding moiety and a cancer-targeting moiety, wherein the T-cell binding moiety has a binding specificity to a T-cell receptor comprising CD3, CD28, PDL1, PD1, OX40, 4-1BB, GITR, TIGIT, TIM-3, LAG-3, CTLA4, CD40, VISTA, ICOS, BTLA, Light, NKp30, CD28H, CD27, CD226, CD96, CD112R, A2AR, CD160, CD244, CECAM1, CD200R, TNFRSF25 (DR3), or a combination thereof, and wherein the cancer targeting moiety has a binding specificity to a cancer cell receptor.

The application relates to a hybridoma cell strain 1B6A2 secreting an anti-fish T lymphocyte surface membrane protein CD28 monoclonal antibody, the hybridoma cell strain 1B6A2 is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: C202291, and the preservation date is May 5, 2022. The application provides a powerful tool for simulating a second signal in vitro and exploring a CD28-mediated T cell adaptive immune response mechanism.

The invention belongs to the field of biological medicine, and relates to a method for preparing iTNK cells, prepared iTNK, a pharmaceutical composition of the iTNK and application of the iTNK. Specifically, the invention relates to a method for preparing iTNK cells, which comprises the following steps: (1) adding a proper amount of anti-CD3 / CD28 / CD2T cell Activator into a culture medium for culturing T cells; culturing for 1-4 days; preferably culturing for 2 days; (2) replacing the culture medium with a culture medium which does not contain anti-CD3 / CD28 / CD2T cell Activator, and continuously culturing for 20 to 30 days; preferably, the culture lasts for 26 days. The iTNK cell prepared by the method disclosed by the invention has dual attributes of cytotoxic T cells and NK cells and a tumor killing function, and has a good anti-tumor application prospect.

Provided are trispecific T Cell Engagers or TSMAb's, antibodies that can simultaneously engage three different types of epitopes on the same target or on different targets. More specifically, the invention is directed to trispecific molecules that bind to DLL3, MUC17 or CLDN18.2 and activate CD (cluster of differentiation) molecules (e.g. CD3, CD28 and CD137). Also provided are methods of treating an ailment such as cancer using an antibody (or fragment) against DLL3, MUC17 or CLD18 paired with an antibody (or fragment) of an agonist antibody that activates CD3, CD28 and / or CD137.

The present invention provides bispecific antigen-binding molecules comprising a first antigen-binding domain that binds specifically to human CD28, and a second antigen-binding domain that binds specifically to human MUC16. In certain embodiments, the bispecific antigen-binding molecules of the present invention can inhibit the growth of tumors expressing MUC16, such as ovarian tumors. The antibodies and bispecific antigen-binding molecules of the invention are useful for the treatment of diseases and disorders in which an upregulated or induced targeted immune response is convenient and / or therapeutically beneficial.

Provided is a method of treating cancer in an individual by administering to the individual modified cells that express a chimeric antigen receptor (CAR) that contain a TIGIT extracellular domain that can bind to poliovirus receptor (PVR), a CD28 segment, and a CD3ζ segment. The modified cells may co-express and secrete a Bi-specific T cell engager (BiTE). The BiTE includes a segment that can specifically bind to human Folate Receptor alpha (FRα) and a segment that that can specifically bind to a human CD3□ segment. Modified cells that express the CAR, and may also express and secrete the BiTE, and polynucleotides encoding the CAR and the BiTE, are also provided.

Provided are bispecific T Cell Engagers. More specifically, the invention is directed to bispecific molecules that bind to DLL3, MUC17 or CLD18 and activate CD (cluster of differentiation) molecules (e.g. CD3, CD28 and CD137). Also provided are methods of treating an ailment such as cancer using an antibody (or fragment) against DLL3, MUC17 or CLD18 paired with an antibody (or fragment) of an agonist antibody that activates CD3, CD28 and / or CD137.

The present disclosure provides methods for treating prostate cancer or metastatic castration-resistant prostate cancer, reducing the severity of prostate cancer or metastatic castration-resistant prostate cancer, or inhibiting the growth of prostate cancer or metastatic castration-resistant prostate cancer. The methods of the present disclosure comprise administering to a subject in need thereof a therapeutically effective amount of a bispecific antibody, or antigen-binding fragment thereof, that specifically binds to prostate specific membrane antigen (PSMA) and CD28, as a monotherapy or in combination with an anti-PD1 antibody.

The present application relates to a kind of based on logic gate double-target point chimeric antigen receptor modified TIL cell, lentivirus expression vector and application, belong to tumor immunotherapy and gene editing technical field.The TIL cell based on logic gate double-target point chimeric antigen receptor modified in the application, double-target point chimeric antigen receptor includes chimeric antigen receptor EGFR and chimeric antigen receptor GD2;Chimeric antigen receptor EGFR is composed of CD8 alpha signal peptide, anti-EGFR single-chain antibody, CD8 alpha transmembrane region, 4-1BB costimulatory domain and CD3 zeta intracellular signal domain in series;Chimeric antigen receptor GD2 is composed of CD8 alpha signal peptide, anti-GD2 single-chain antibody, CD28 transmembrane region, CD27 costimulatory domain and CD3 zeta intracellular signal domain in series.The present application solves the defects that lentivirus transduction targeting is poor in prior art, CAR signal activation specificity is insufficient, TIL cell is easily exhausted, has the advantages that gene integration is accurate, signal transduction is controllable, in-vivo survival time is long, can be efficiently used for the immunotherapy of double-antigen co-expression solid tumor.

The present disclosure relates to methods of treating or inhibiting the growth of a tumor, wherein the methods include selecting a subject with cancer and administering to the subject in need thereof a therapeutically effective amount of a cancer vaccine (e.g., mRNA vaccine against a tumor) in combination with a bispecific antigen-binding molecule comprising a first antigen-binding domain that binds specifically CD28 and a second antigen-binding domain that binds specifically to a tumor-associated antigen (TAA). The combination therapy demonstrates increased anti-tumor efficacy, increased duration of tumor control and / or increased overall survival, as compared to a subject administered the cancer vaccine as monotherapy.

The present invention relates to PD-L1xCD28 bispecific antibodies that act as immune checkpoint inhibitors by binding and blocking PD-L1 (thus preventing it from binding to PD-1 expressed on T cells) and can further deliver a co-stimulatory signal to T cells by aggregating and competitively binding to CD28.

Multispecific antibodies that bind to an effector associated antigen (EAA), such as CD28, and a disease associated antigen (DAA), such as Nectin-4, are provided, along with methods of making such antibodies, compositions, including pharmaceutical compositions, comprising such antibodies, and their use to treat disorders, such as cancer, where modulation of effector cell activity against target cells can be used as a treatment modality.

The application relates to the diagnosis and treatment of diseases, including cancer, chronic infectious diseases, autoimmune diseases, inflammatory disorders, as well as the prevention of transplant rejection. The invention provides, and involves the use of, antibody molecules that bind CD28 in a non super-agonistic manner and which also bind to CTLA-4. The antibody molecules may form part of a bispecific molecule which binds e.g. a tumor associated antigen or a further T cell antigen, such as CD3.

The present disclosure relates to methods of culturing immune cells, e.g., T cells, NK cells, and / or TILs, for an immune cell therapy, wherein the immune cells are contacted with a CD28 agonist, and wherein the immune cells are not contacted with a CD3 agonist. In some aspects, the methods disclosed herein promote the enrichment of immune cells having a less-differentiated phenotype, i.e., expressing markers characteristic of stem cell-like memory T (Tscm) cells. Cells cultured using the methods disclosed herein can be used for various cell therapies, including but not limited to chimeric antigen receptor (CAR) T cell therapy and TCR T cell therapy, including neoantigen directed-T cell therapies.

Provided are an anti-CD28 antibody or an antigen-binding fragment thereof, and a multi-specific antibody constructed on the basis of the antibody or the antigen-binding fragment thereof. The multi-specific antibody comprises an anti-CD3×CD28 bispecific antibody and an anti-tumor-associated antigen (TAA)×CD3×CD28 trispecific antibody. Further provided are a nucleic acid molecule encoding the antibody or the antigen-binding fragment thereof, a vector and a cell comprising the nucleic acid molecule, a pharmaceutical composition comprising the antibody or the antigen-binding fragment thereof, and the use of the antibody or the antigen-binding fragment thereof, in particular for the treatment of tumors or immunodeficiency diseases.

Provided are bispecific T Cell Engagers. More specifically, the invention is directed to bispecific molecules that bind to DLL3, MUC17 or CLD18 and activate CD (cluster of differentiation) molecules (e.g. CD3, CD28 and CD137). Also provided are methods of treating an ailment such as cancer using an antibody (or fragment) against DLL3, MUC17 or CLD18 paired with an antibody (or fragment) of an agonist antibody that activates CD3, CD28 and / or CD137.

Disclosed herein are monospecific and multispecific antibodies specific for CD28 and CD3E, and one or more of OX-40, CD40, 4-1BB, HSA, IL-22, PD-L1, CD16, CD47, CD33, LAG3, and EGFR.

The invention discloses a CD8 + T cell culture solution and application thereof. The cell culture solution comprises an induction culture solution and an amplification culture solution, wherein the amplification culture solution comprises a basic culture medium, and the basic culture medium contains ginsenoside with the final concentration of 20-100 [mu] g / mL, concanavalin A with the final concentration of 20-100 [mu] g / mL and IL-2 with the final concentration of 100-1000 U / mL; the induction culture solution is based on an amplification culture medium, and a CD3 antibody with the final concentration of 50-100 ng / mL and a CD28 antibody with the final concentration of 50-100 ng / mL are added. The ginsenoside component in the CD8 + T cell culture fluid can induce and stimulate PBMC to be differentiated into CD8 + T cells, and concanavalin A cooperates with ginsenoside to promote rapid amplification and growth of the CD8 + T cells; meanwhile, the cell culture method is simple to operate and low in cost, and has certain universality.

To provide an allogeneic tumor cell vaccine.SOLUTION: Provided is an allogeneic tumor cell vaccine, comprising: (1) a population of proliferation-incompetent, live, genetically engineered tumor cells expressing one or more tumor-specific antigens, the population comprising at least three stably expressed immunomodulatory molecules, at least three immunomodulatory molecules being OX40 ligand (OX40L), CD27 ligand (CD70), and CD28 ligand (CD28L) including CD80, CD86, or both, to induce one or more subpopulations of PBMCs to proliferate in response to the expressed immunomodulatory molecules and subsequently enter an effector phase to kill tumor cells, and the subpopulations of PBMC cells comprising one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs), or B lymphocytes; and (2) a pharmaceutically acceptable carrier.SELECTED DRAWING: None

The present application provides an anti-CD38 CAR molecule for shRNA targeted inhibition of CD38, including an anti-CD38 CAR molecule for shRNA targeted inhibition of CD38, characterized by comprising U6 promoter, shRNA targeted inhibition of CD38, EF1 alpha promoter, upstream signal peptide and myc tag for detection in series; CD38 CAR antigen binding region CD38 scfv; CD8 hinge-transmembrane domain; CD28 costimulatory domain and CD3 zeta intracellular signaling domain, CD38 ScFv, CD8 hinge region and transmembrane region, CD28 intracellular region and CD3 zeta intracellular region are connected in series, the shRNA sequence targeted to inhibit CD38 is SEQ ID NO. 1: CCGGCTGAGGATTCATCTTGCACATCTCGAGATGTGCAAGATGAATCCTCAGTTTTTG. The present application successfully constructs an anti-CD38 CAR-T cell for shRNA targeted inhibition of CD38 through the popular shRNA technology of gene research, provides a new method for anti-CD38 CAR-T cell to get out of the "CAR-T cell-autophagy and self-stimulation" cycle, and helps to further enhance the expansion, persistence and function of anti-CD38 CAR-T cell in subsequent research.

The anti-CD40L / anti-CD28 bispecific antibody according to the present application comprises anti-CD40L scFv and anti-CD28 scFv, and thus does not exhibit a thromboembolic side effect, can exhibit an excellent effect of treating autoimmune diseases and / or graft versus host diseases while preventing a T cell activation effect caused by CD28 dimer formation, and can be used as a novel anti-CD40L / anti-CD28 bispecific antibody. In addition, excellent bispecific antibody physical characteristics can be shown.

The invention relates to the technical field of biological medicine, and particularly discloses a chimeric antigen receptor of a targeted NKG2D ligand, a nucleic acid molecule, an expression vector, a macrophage and a preparation method and application of the chimeric antigen receptor, the nucleic acid molecule, the expression vector and the macrophage, and an extracellular antigen binding domain is an NKG2D extracellular structural domain; the hinge region is a CD28 hinge region or a CD8a hinge region; the transmembrane / intracellular signal transduction structural domain is an FCGR1 transmembrane / intracellular signal transduction structural domain or a CD3z transmembrane / intracellular signal transduction structural domain. The chimeric antigen receptor provided by the invention specifically recognizes and is combined with NKG2DLs highly expressed in NKG2DL positive malignant tumors, and macrophages expressing the chimeric antigen receptor can directly swallow tumor cells, promote M1 type polarization, reprogram tumor microenvironment and induce recruitment and activation of T cells, so that effective treatment of the malignant tumors is realized.

The application discloses a kind of FAP targeted chimeric antigen receptor regulatory T cells, its preparation method and application, belong to biomedical technology field.The FAP targeted chimeric antigen receptor regulatory T cell contains chimeric antigen receptor, the chimeric antigen receptor includes single-chain antibody targeted to FAP, CD8 alpha hinge region, CD8 transmembrane region, CD28 signal region and CD3 zeta signal region, its nucleotide sequence is as shown in SEQ ID NO.1.The FAP targeted chimeric antigen receptor regulatory T cell can effectively accumulate in damaged heart, and control the excessive fibrosis and inflammatory response in MI, which not only highlights the therapeutic potential of CAR Tregs against FAP in promoting heart healing, but also lays the foundation for CAR Treg treatment in clinical environment of severe MI.

The application provides anti-CD28 nanobodies and uses thereof, and belongs to the technical field of biotechnology. Specifically disclosed are several CD28-targeted nanobodies, coding sequences and expression vectors for producing the nanobodies, and application of the nanobodies in preparation of tumor treatment drugs. The nanobodies can not only specifically recognize and bind to CD28, laying a foundation for subsequent development of antibody conjugated drugs and multi-specific antibodies, but also can be combined with tumor antigen-targeted antibodies to form multi-specific antibodies, and the formed multi-specific antibodies significantly enhance the ability of activated T cells and the activity of killing tumor cells.

Provided is a fusion polypeptide. The polypeptide contains a first domain, a second domain and a third domain, wherein the first domain is capable of binding to CD3, the second domain is capable of binding to a tumor-associated antigen (TAA), and the third domain is capable of binding to CD28 and / or CTLA4.

The present invention relates to PD-1-CD28 fusion proteins, nucleic acid molecules, vectors, transduced cells carrying nucleic acid molecules or vectors of the present invention or expressing the fusion proteins of the present invention, methods and kits comprising the nucleic acid molecules, vectors and / or the fusion proteins of the present invention. The invention also provides the use of said transduced cells in a method for the treatment of particular diseases as well as a pharmaceutical composition / medicament comprising said transduced cells expressing the fusion proteins of the present invention for use in a method of treating of diseases, in particular in the medical intervention of diseases characterized by PD-L1 and / or PD-L2 expression.

Provided herein are novel anti-CD20x anti-CD28 antibodies and methods of using such antibodies to treat B cell malignancies. The subject anti-CD20x anti-CD28 antibodies are capable of agonically binding to a CD28 costimulatory molecule on a T cell and to CD20 on a tumor cell. Thus, such antibodies enhance anti-tumor activity at tumor sites. The subject antibodies provided herein are particularly useful in the treatment of B-cell malignancies in combination with other anti-cancer therapies (e.g., anti-CD3 x anti-CD20 x anti-CD79b antibodies).