Specific primer pair of Pantoea beijing and its application
A specific primer pair, pantoea technology, applied in the directions of microorganisms, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of industrial production loss and difficult control of Pleurotus eryngii
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1. Identification of Pantoea beijingensis using PCR primers for ALF-ALR
[0029] 1. PCR reagents for identifying Pantoea beijingensis
[0030]The PCR reagent for the identification of Pantoea Beijingi in this embodiment consists of the Pantoea Beijingi specific primer pair ALF-ALR, 2×Taq PCRMix (Bioeasy) and ddH 2 O composition.
[0031] Among them, the Pantoea beijing specific primer pair ALF-ALR is composed of ALF (upstream primer) and ALR (downstream primer), the nucleotide sequence of ALF is 5'ATCTCTCAGACAAGCCCCGTTAGTAACAACT 3'(SEQ ID No.1), the nucleotide sequence of ALR The sequence is 5'GATTTTCCTTCACATATTCCACTGCACGAG 3' (SEQ ID No. 2).
[0032] 2. Identification of Pantoea beijingensis
[0033] 2.1. DNA extraction of strains
[0034] Strains preserved from -80°C (Pantoea beijingensis sp.nov.) JZB2120001 T Pantoea gaviniae DSM22758; Pantoea eucalypti DSM23077; Pantoea anthophila DSM23080; T ) was streaked in solid LB medium, cultivated at 28°C for 20...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


