Application of expression gene of mannosidase i
A technology of mannosidase and gene expression, which is applied in the field of bioengineering, can solve the problems of long time required for enzymatic hydrolysis, low catalytic efficiency of enzymatic hydrolysis, and large amount of enzyme, so as to improve the activity of catalytic degradation of cellulose and realize rational utilization , the effect of increasing production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] Knockout the expression gene of mannosidase I in Trichoderma reesei, the steps are as follows:
[0076] (1) Using the genome of Trichoderma reesei as a template, PCR amplification was performed with specific primers mns1p up F and mns1p up R, and purified using OMEGA's Cycle Pure Kit (refer to the kit manual for the method) to obtain the upstream synaptic source arm;
[0077] The nucleotide sequences of specific primers are as follows:
[0078] mns1p up F: TAGGGATAACAGGGTAATGGATTGACATGACACGCCCTTAGAA
[0079] mns1p up R: GGGGACAAGTTTGTACAAAAAAGCAGGCTAAGTCGGTTATGCTGTAATGCGTGATT;
[0080] The PCR reaction conditions are as follows:
[0081] Pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1-2 minutes, and 30 cycles of reaction; extension at 72°C for 10 minutes;
[0082] The PCR reaction system is as follows:
[0083]
[0084] The upstream homology arm obtained by PCR amplification ...
Embodiment 2
[0099] Determination of Exocellulase 1 (CBH1) and Protein Secretion Ability of Δmns1p Strain
[0100] 2.1 Inoculation of Trichoderma reesei spores in Trichoderma reesei preculture medium 10 6 One, 30 ℃, 200 rpm culture for 36 hours, use G1 sand core funnel to collect mycelia and transfer to fresh Trichoderma reesei pre-cultivation medium to continue culturing for 12 hours, finally collect mycelia and use 24g / L The inoculum amount was transferred to the induction medium, and the culture was continued at 30°C and 200 rpm, and the fermentation broth was taken every 12 hours to detect the expression of cellulase.
[0101] 2.2 The fermentation broth obtained in step 2.1 was detected by Western Blot using a polyclonal antibody to cellulase CBH1.
[0102] 1) The sample was subjected to SDS-PAGE electrophoresis, the concentration of the separating gel was 8wt% (refer to the "Protein Operation Manual" for the method), and then the protein was transferred to the PVDF membrane by electr...
Embodiment 3
[0114] Detection of Cellulose Degradation Ability of Fermentation Supernatant of Δmns1p Strain
[0115] 3.1 Detection of the ability of fermentation supernatant to degrade Avicel
[0116] 1) Weigh each EP tube and weigh 0.05g into each EP tube PH-101 (Sigma);
[0117] 2) Add the fermentation broth obtained in step 2.1, place it in a shaker at 50°C for 48 hours, centrifuge at 13400rpm for 1min, and take the supernatant;
[0118] 3) Mix 100 μl supernatant diluted with different times with 100 μl DNS, and boil at 100°C for 5 minutes;
[0119] 4) Centrifuge at the maximum speed for 5 minutes, pipette 180 μl of the supernatant into a 96-well plate, OD 550 To detect its absorbance value;
[0120] 5) Calculate the amount of reducing sugar according to the prepared standard curve; weigh the EP tube again to calculate the loss of Avicel.
[0121] Depend on Figure 7 and Figure 8 It can be seen that the knockout of mns1p increases the ability of Trichoderma reesei to degrade Av...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More