Reagent and application for detecting mutation of forkhead transcription factor o1 gene

A technology for detecting reagents and reagents, applied in the field of reagents for the detection of forkhead transcription factor O1 gene mutations, can solve the problems of reducing and affecting Wnt signal pathway conduction, and achieve the effects of simple experimental operation, improved detection specificity, and inhibited amplification

Active Publication Date: 2019-08-02
HUBEI UNIV OF TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The study found that in the state of oxidative stress, FOXOs can competitively bind to β-catenin, reducing the binding of the latter to TCF, thus affecting the conduction of Wnt signaling pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent and application for detecting mutation of forkhead transcription factor o1 gene
  • Reagent and application for detecting mutation of forkhead transcription factor o1 gene
  • Reagent and application for detecting mutation of forkhead transcription factor o1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] [Example 1] Primer probe design

[0039] According to the FOXO1 mRNA sequence (NCBIReference Sequence: NM_002015.3) reported by the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov), using Applied Biosystems PrimerExpress Software for Real-Time PCR software design specific FOXO1 primers and probes.

[0040] FOXO1 R609C:

[0041] FOXO1-F:5'-CCTTTCTCCACCAGGAGAAGCTC-3'; (SEQ NO.1)

[0042] FOXO1-R:5'-CTTGACACTGTGTGGGAAGCTT-3'; (SEQ NO.2)

[0043] Mutant FOXO1(PNA)-P: 5'FAM-TGTTCATTGAGTGCTTAGAC-BHQ 3'; (SEQ NO.5)

[0044] Wild-type FOXO1-PNA: 5'-TGTTCATTGAGCGCTTAG-3'; (SEQ NO.7)

[0045] Mutant target sequence:

[0046] 9()

[0047] Wild-type target sequence:

[0048] (SEQ NO. 10)

[0049] FOXO1 D624N:

[0050] FOXO1-F:5'-CCTTTCTCCACCAGGAGAAGCTC-3'; (SEQ NO.3)

[0051] FOXO1-R:5'-CTTGACACTGTGTGGGAAGCTT-3'; (SEQ NO.4)

[0052] FOXO1(PNA)-P: 5'FAM-AATGACCTCATGAATGGAGATA-BHQ 3'; (SEQ NO.6)

[0053] FOXO1-PNA: AATGACCTCATGGATGGAGA; (...

Embodiment 2

[0062] [Example 2] Construction of recombinant plasmids containing FOXO1 gene mutant and wild-type DNA fragments

[0063] 1. Human endometrial carcinoma Ishikawa cell line culture and passage

[0064] 1) Cell culture

[0065] All cell lines were cultured in RPMI-1640 medium (Invitrogen, Carlsbad, CA) and 10% fetal bovine serum (Invitrogen, Carlsbad, CA) at 37°C and 5% CO2.

[0066] 2) Cell passage

[0067] First, use a sterilized pipette to suck out the culture medium in the cell culture dish, add PBS buffer to wash twice, slowly add an appropriate amount of trypsin to the cells, wait until the cells become round, adjust the angle and the cells can move, then add 3ml of 10 DMEM medium with % fetal bovine serum, after repeatedly blowing gently, observe the cell morphology and count under the microscope, pass appropriate amount of cells to other sterilized culture dishes according to the content of cells in the culture dish, add 5ml of DMEM medium Then put into 5% CO2 incubat...

Embodiment 3

[0091] [Example 3] Amplified sample by real-time fluorescent quantitative PCR method

[0092] Take 1-5 μg of extracted total RNA and add it to the PCR reaction solution, which includes: sterile water, DNA polymerase with 5'→3' exolytic activity, dNTPs, 10×PCR Buffer, RNASIN, M-MLV reverse transcription Enzymes, oligo(dT) and solutions containing Mg ions. Among them, 0.3 μL of DNA polymerase with 5’→3’ exolytic activity at a concentration of 5 U / μL, 2 μL of dNTPs at a concentration of 10 mmol / L, 5 μL of 10×PCR Buffer, 0.6 μL of RNASIN at a concentration of 40 U / μL, and a concentration of 0.6 μL of M-MLV reverse transcriptase at 200 U / μL, MgCl at a concentration of 25 mmol / L 2 Solution 5 μL, add sterile water to a volume of 50 μL. Wherein, the DNA polymerase with 5'→3' excision activity can be Taq enzyme.

[0093] PCR amplification: put each reaction tube into the reaction tank of the fluorescent quantitative PCR instrument, set the type of labeled fluorescent group, sample n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reagent used for detecting forkhead transcription factor O1 (FOXO1) gene mutation, a polymerase chain reaction (PCR) detection method and an application, belonging to the technical field of basic biological research and biological detection. The detection reagent comprises primers, peptide nucleic acid (PNA) fluorescent probes and wild type complementary PNA sequences, wherein the forward primers are shown in SEQ ID NO.1 and NO.3 in a sequence table; the reverse primers are shown in SEQ ID NO.2 and NO.4 in the sequence table; the PNA fluorescent probes are shown in SEQ ID NO.5 and NO.6 in the sequence table; and the wild type complementary PNA sequences are shown in SEQ ID NO.7 and NO.8 in the sequence table. The reagent can rapidly discover mutation of the FOXO1 gene in a Wnt signal pathway from the transcriptional level, has the obvious advantages of strong specificity, high sensitivity, and the like and provides a tool for anti-cancer drug screening, new targeted drug discussion and basic scientific research.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and clinical molecular diagnosis, in particular to a reagent, a PCR detection method and an application for detecting a forkhead transcription factor O1 (FOXO1) gene mutation. Background technique [0002] The Wnt signaling pathway widely exists in invertebrates and vertebrates, and is a highly conserved signaling pathway in the evolution of species. Wnt signaling plays a vital role in the early development of animal embryos, organ formation, tissue regeneration and other physiological processes. If the key protein in this signaling pathway is mutated or abnormally expressed, leading to abnormal activation of the signal, it may induce cancer. The Wnt signaling pathway includes the classic Wnt signaling pathway and the non-canonical Wnt signaling pathway. In the classic pathway, the Wnt-β-catenin signaling pathway, the Wnt factor inhibits intracellular free cells by activating the Frizz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6886C12Q1/6858
CPCC12Q1/6858C12Q1/6886C12Q2600/156C12Q2531/113C12Q2525/107C12Q2561/101
Inventor周策凡唐景峰陈兴珍张毅秦文英
OwnerHUBEI UNIV OF TECH