Detection for methylated sites of human genes NUDT2 and PCDH8 and applications of methylated sites of human genes NUDT2 and PCDH8
A methylation and site technology, applied in the field of methylation quantitative information change, can solve the problem of unreported relationship between liver cancer and other issues, and achieve the effect of rapid and accurate quantitative detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0016] Combine below Attached picture The present invention will be further described in detail with specific embodiments.
[0017] 1. Specific site analysis
[0018] Using the Infinium HumanMethylation27 BeadChip methylation chip to screen the difference between the methylation profiles of primary hepatocellular carcinoma and corresponding paracancerous tissues, it was found that in the genomic DNA of primary hepatocellular carcinoma, the NUDT2 gene promoter region The methylation level of one site (the number of this site in the above methylation chip is cg04322134) was significantly lower than that of the paracancerous group, and the methylation level of a site (cg20366906) in the promoter region of PCDH8 gene was significantly lower than that of Paracancerous group.
[0019] The sequence of the NUDT2 gene-specific site is (SEQ ID No.1):
[0020] CACCTACTTTCCTATCTTTCATCCCCATATCCTCTGCCTTTTCTTCAGCAATTATCTTGAA[CG]CCACTTCTCTCACTTTGGGAGACTAAACTCTTGAGTCCCAAAGCCTTCTTGCTTTTGAAC...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com