Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection for methylated sites of human genes NUDT2 and PCDH8 and applications of methylated sites of human genes NUDT2 and PCDH8

A methylation and site technology, applied in the field of methylation quantitative information change, can solve the problem of unreported relationship between liver cancer and other issues, and achieve the effect of rapid and accurate quantitative detection

Active Publication Date: 2017-03-08
杨小丽
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the relationship between abnormal methylation of the gene promoter region and liver cancer has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection for methylated sites of human genes NUDT2 and PCDH8 and applications of methylated sites of human genes NUDT2 and PCDH8
  • Detection for methylated sites of human genes NUDT2 and PCDH8 and applications of methylated sites of human genes NUDT2 and PCDH8
  • Detection for methylated sites of human genes NUDT2 and PCDH8 and applications of methylated sites of human genes NUDT2 and PCDH8

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0016] Combine below Attached picture The present invention will be further described in detail with specific embodiments.

[0017] 1. Specific site analysis

[0018] Using the Infinium HumanMethylation27 BeadChip methylation chip to screen the difference between the methylation profiles of primary hepatocellular carcinoma and corresponding paracancerous tissues, it was found that in the genomic DNA of primary hepatocellular carcinoma, the NUDT2 gene promoter region The methylation level of one site (the number of this site in the above methylation chip is cg04322134) was significantly lower than that of the paracancerous group, and the methylation level of a site (cg20366906) in the promoter region of PCDH8 gene was significantly lower than that of Paracancerous group.

[0019] The sequence of the NUDT2 gene-specific site is (SEQ ID No.1):

[0020] CACCTACTTTCCTATCTTTCATCCCCATATCCTCTGCCTTTTCTTCAGCAATTATCTTGAA[CG]CCACTTCTCTCACTTTGGGAGACTAAACTCTTGAGTCCCAAAGCCTTCTTGCTTTTGAAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses methylated sites of liver-cancer-related human genes NUDT2 and PCDH8 and applications of the methylated sites of the human genes NUDT2 and PCDH8. According to the methylated sites and the applications, a pyrosequencing method is adopted for quantitatively detecting the methylation level of the specific site cg04322134 of the NUDT2 gene and the site cg20366906 of the PCDH8 gene, a unique primer is designed aiming at each site, and the primers comprise upstream and downstream PCR amplification primers and a pyrosequencing primer, wherein one of the amplification primers is provided with a biotin label. The rapid and accurate quantitative detection can be carried out on the methylation level of the specific sites of the genes NUDT2 and PCDH8, and the result shows that the methylation level of the two sites has obvious change in primary hepatocellular carcinoma patients.

Description

technical field [0001] This study involves human NUDT2 (Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif2, nucleoside diphosphate linking part X-type motif 2) gene and PCDH8 (Protocadherin-8, protocadherin 8) gene-specific DNA (deoxygen Changes in the methylation quantitative information of ribonucleic acid) methylation sites in liver cancer, specifically referring to the application of pyrosequencing technology to find that the methylation degree of the NUDT2 gene-specific DNA methylation site (cg04322134) is reduced in liver cancer ; PCDH8 gene-specific DNA methylation site (cg20366906) is highly methylated in liver cancer. These provide support for exploring the pathogenesis of liver cancer and finding potential markers related to diagnosis or treatment. Background technique [0002] Liver cancer is the third most lethal malignant tumor in the world, and it is also the second cancer "killer" in my country. At present, the treatment of liver cancer is mainly bas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 杨小丽张悦宁刘坤李佳桐张成东林志弟肖非凡
Owner 杨小丽