A fusion protein containing tumor necrosis factor-related apoptosis-inducing ligand, its preparation method, and nanoparticles self-assembled by the protein

An apoptosis-inducing ligand and tumor necrosis factor technology, which is applied in the preparation method of peptides, chemical instruments and methods, and microbial-based methods, can solve problems such as difficulty in obtaining solubility, affecting anti-tumor effect, and short half-life

Active Publication Date: 2020-03-27
NANJING UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RGD-TRAIL has 5 cysteines or two pairs of disulfide bonds. If it is expressed and purified in E.coli, it is difficult to obtain soluble RGD-TRAIL
In addition, RGD-TRAIL has a smaller particle size (8nm) and a shorter half-life in vivo, which will affect its anti-tumor effect in vivo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fusion protein containing tumor necrosis factor-related apoptosis-inducing ligand, its preparation method, and nanoparticles self-assembled by the protein
  • A fusion protein containing tumor necrosis factor-related apoptosis-inducing ligand, its preparation method, and nanoparticles self-assembled by the protein
  • A fusion protein containing tumor necrosis factor-related apoptosis-inducing ligand, its preparation method, and nanoparticles self-assembled by the protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Construction of RGD-TRAIL-ELP plasmid

[0028] ELP[VH 4 -5] The gene sequence is: 5'-CCAC GGC GTGGGTGTTCCGGGCGTAGGTGTCCCAGGTCACGGCGTACCGGGCCACGGTGTTCCTGGTCACGGCGTGCCG GGC TGGC-3 (its amino acid sequence is VPG V G-VPG H G-VPG V G-VPG H G-VPG H G), synthesized by Nanjing GenScript Company, ELP[VH 4 -40] (8 ELP[VH 4 -5] sequence repeat) by ELP [VH 4 -5] extended by the RDL method; ELP[VH 4 -40] connected with the RGD-TRAIL gene fragment pET-23a through BamHI and HindIII. All target gene sequences were identified by sequencing (T7 and T7-ter). It was identified by sequencing that the RGD-TRAIL-ELP gene had been inserted into NdeI and HindIII in pET-23a.

Embodiment 2

[0029] Example 2 Expression, purification and identification of RGD-TRAIL-ELP

[0030]After the RGD-TRAIL-ELP plasmid was transferred into BL21(DE3), engineered bacteria were constructed and cultured in 4 liters of TB medium. When the OD value reached 0.6, induction was added with IPTG and induced overnight at 30°C. The bacteria were collected and used Ultrasonic breaker for cell disruption, bacterial disruption liquid centrifuged at 4 degrees at 12000g for 5 minutes to take the supernatant; heat the supernatant at 40 degrees, centrifuge at 40 degrees at 12000g for 5 minutes, take the precipitated part; put the precipitated part in pre-cooled PBS Dissolve the buffer solution, put it at 4°C for 15 minutes, centrifuge at 12000g at 4°C for 5 minutes to take the supernatant, then centrifuge at 4°C to take the supernatant and take the precipitate at 40°C for three cycles.

[0031] Use SDS-PAGE to identify the soluble expression of RGD-TRAIL-ELP in E.coli and analyze the protein pur...

Embodiment 3

[0033] Example 3 Detection of apoptosis-inducing effect of fusion protein

[0034] Human colon cancer cells (Human COLO rectal carcinoma cells, COLO205 cells) were used to detect the activity of the purified RGD-TRAIL-ELP. COLO205 was cultured in RPMI 1640 containing 10% bovine serum. cells (10 5 ) after a series of concentration gradients of RGD-TRAIL or RGD-TRAIL-ELP induction treatment, digested with trypsin, aspirated from the culture well, washed twice with PBS, centrifuged at 300g for 5 minutes, discarded the supernatant, and then used 300μL binding buffer The solution was resuspended, and Annexin V-FITC with a final concentration of 2 μg / mL was added to incubate at room temperature. After 10 minutes, the cells were transferred to flow tubes. Cytometry analysis.

[0035] The result is attached image 3 As shown, the half dose (EC50) of RGD-TRAIL and RGD-TRAIL-ELP is 1 and 0.35nM (20.57 and 13.61ng / ml), respectively, so the apoptosis-inducing activity of RGD-TRAIL-ELP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
molecular weightaaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of bio-pharmaceuticals and particularly relates to expression, purification and self-assembly of TRAIL variant proteins. A recombinant protein is expressed by plasmids comprising the TRAIL fusion proteins in escherichia coli, and the recombinant protein with high activity is produced. The recombinant proteins adopt a centrifugal mode for simple and rapid purification. The purified proteins are self-assembled into particles being 200 nanometers under the physiological conditions. After intravenous injection to a tumor transplantation mouse, the recombinant protein is effectively gathered in the tumor location of the mouse. The recombinant protein is injected into the tumor transplantation mouse in an intraperitoneal injection mode, and tumor growth is effectively suppressed. The recombinant protein subjected to simple process purification is used for oncotherapy.

Description

[0001] 1. Technical field [0002] The invention belongs to the field of biopharmaceuticals, and in particular relates to the preparation and application of a TRAIL variant protein. [0003] 2. Background technology [0004] Tumor necrosis factor-related apoptosis-inducing ligand (TNF-related apoptosis-inducing ligand, TRAIL) is a new member of the TNF superfamily, which binds to death receptor 4, 5 (death receptor 4, 5, DR4, After DR5) is combined, the death-inducing signaling complex (DISC) is formed. DISC binds to Caspase8 precursor, activates Caspase8 precursor and hydrolyzes Caspase8 precursor, thereby activating caspases-3, -6 and -7, thereby cause apoptosis. Because TRAIL can selectively induce apoptosis in various malignant tumors such as melanoma, lymphoma, colon cancer, lung cancer and breast cancer, but has little effect on most normal cells, TRAIL is a very promising anti-tumor drug (Ichikawa et al., Cancer Res, 2001; Frese et al., Nat Med, 2006). [0005] In ord...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/70C12N1/21C07K1/14A61K38/17A61K47/64A61P35/00C12R1/19
CPCA61K38/00C07K14/70575C07K2319/00
Inventor华子春黄凯宗
OwnerNANJING UNIV