Soybean GmABC protein and encoding gene and application thereof

A protein and coding technology, applied to soybean GmABC protein and its encoding gene and application fields, can solve the problems of rare soybean ABC protein and one-sided research, and achieve the effects of improving crop yield, improving drought resistance and broad application prospects.

Inactive Publication Date: 2017-04-05
QINGDAO AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on the function of soybean ABC protein is also very rare, and the research is relatively one-sided

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean GmABC protein and encoding gene and application thereof
  • Soybean GmABC protein and encoding gene and application thereof
  • Soybean GmABC protein and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, the cloning of soybean GmABC gene

[0050] 1. Cloning of GmABC gene

[0051] Combined with soybean gene chip data, ESTs with significantly different expressions under drought stress were screened out, and the nucleotide sequence of the corresponding probe GmaAffx.83637.1.S1_at was used to search the soybean genome database at http: / / www.phytozome.net / soybean. Open reading frames were predicted from the matched genome sequences using the FGENESH program. Using the predicted sequence as a probe, search the soybean dbEST database, download the matching sequence, BLASTN: score>200; E-value

Embodiment 2

[0071] Embodiment 2, the application of GmABC in regulating soybean stress tolerance

[0072] 1. Obtaining of overexpressed GmABC soybean lines

[0073] 1. Construction of GmABC gene plant overexpression vector

[0074] According to the sequence in Sequence Table 1 and the restriction site of the expression vector, primers were designed for constructing the recombinant vector. The primer sequences are

[0075] ORF-F (5'-3'):GAAGATCTTCAAGCATGTTGTGAAGGCT

[0076] ORF-R (5'-3'): CATGCCATGGTGCTGGCCTCTCCAATTTGT

[0077] The pMD18T-GmABC recombinant plasmid was used as a template for PCR amplification. The PCR reaction conditions were: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 s, refolding at 62°C for 30 s, extension at 72°C for 3 minutes, and 30 cycles; extension at 72°C for 5 minutes. Gel recovery of PCR products was performed using QIA-quick GelExtraction Kit (purchased from QIAGEN, Germany). The recovered product and the plant expression vector pCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides soybean GmABC protein and an encoding gene and application thereof, belongs to the field of genetic engineering and provides an application of any one of substances (1) to (3) to improvement of abiotic stress resistance of plants. The three substances include (1) protein GmABC, (2) DNA molecules used for encoding the protein GmABC and (3) a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria including the DNA molecules used for encoding the protein GmABC. The protein GmABC amino acid sequence refers to sequence 2 in the sequence table. Experimental results show that the protein and the encoding gene of the protein are of great significance to cultivating stress-tolerant high-yield plant varieties.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a soybean GmABC protein and its coding gene and application. Background technique [0002] ABC (ATP-Binding Cassette) transporters are currently the largest and most versatile protein family known, and most ABC transporters can use the energy released by the hydrolysis of ATP to directly transport substrates, including peptides, sugars, lipids, and heavy metal chelates Compounds, polysaccharides, alkaloids, steroids, inorganic ions and glutathione conjugates and other compounds. ABC transporters are closely related to some important physiological processes in prokaryotes and eukaryotes, such as drug resistance of bacteria, cystic fibrosis and drug resistance of tumor cells, which has attracted widespread attention. [0003] In 1992, the first plant ABC transporter, namely AtPGP1 (also known as AtMDR1) cloned from Arabidopsis thaliana was reported internationally in 1992. Since the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/11A01H5/00
CPCC07K14/415C12N15/8273C12N15/8293
Inventor 宋雯雯段方猛
Owner QINGDAO AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap