Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for knocking out CASP3 gene in mesenchymal stem cells using CRISPR-CAS system

A technology of stem cells and bone marrow mesenchyme, applied in the direction of introducing foreign genetic material using vectors, other methods of inserting foreign genetic material, DNA/RNA fragments, etc., can solve the problem of siRNA not being stable and genetic, and achieve high knockout efficiency, The effect of passage stability

Active Publication Date: 2018-08-28
天津金匙医学科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to provide a mesenchymal stem cell that knocks out the CASP3 gene, which effectively overcomes the technical defect of using siRNA to interfere with stable inheritance in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out CASP3 gene in mesenchymal stem cells using CRISPR-CAS system
  • Method for knocking out CASP3 gene in mesenchymal stem cells using CRISPR-CAS system
  • Method for knocking out CASP3 gene in mesenchymal stem cells using CRISPR-CAS system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1, construction of CRISPR expression vector

[0056] gRNA design

[0057] According to the gene sequence of the target gene, through the applicant's unique optimization design method, the specific form of sgRNA obtained through specific screening is as follows:

[0058] CASP3-sgRNA1:5'to 3'ttggaaccaaagatcataca

[0059] CASP3-sgRNA2:5'to 3'ggaagcgaatcaatggactc

[0060] CASP3-sgRNA3:5'to 3'aatggactctggaatatccc

[0061] CASP3-sgRNA4:5'to 3'atgtcgatgcagcaaacctc

[0062] CASP3-sgRNA5:5'to 3'tgtcgatgcagcaaacctca

[0063] CASP3-sgRNA6:5'to 3'ggaataatttttggaacaaa

[0064] CASP3-sgRNA7:5'to 3'gatcgttgtagaagtctaac

[0065] CASP3-sgRNA8:5'to 3'acccaaacttttcattattc

[0066] CASP3-sgRNA9:5'to 3'cagtggtgttgatgatgaca

[0067] CASP3-sgRNA10:5'to 3'ggcgtgtcataaaataccag

[0068] CASP3-sgRNA11:5'to 3'gtgtcataaaataccagtgg

[0069] CASP3-sgRNA12:5'to 3'cagcacctggttatattctct

[0070] CASP3-sgRNA13:5'to 3'gaaattcaaaggatggctcc

[0071] CASP3-sgRNA14:5'to 3'aatttatgcacatt...

Embodiment 2

[0076] Example 2 Cloning of potentiating protein CREnhancer1.0 and constructing vector

[0077] The CREnhancer1.0 gene was cloned, and the gene sequence described in SEQ ID NO: 1 was obtained by the method of whole gene synthesis. Using this sequence as a template, according to the sequences of the upstream and downstream primers, they were 5'-ATGCAGGAGAACCTGGCCCCCTG-3', 5 '-CAGGCAGCTCACGCTCCTCTCG-3', primers and whole genome were synthesized by Shanghai Sangong Co., Ltd. The target gene fragment of CREnhancer1.0 gene was amplified by PCR reaction. The amplification reaction system was as follows: 95°C, 40s, 57°C, 1min, 72°C, 1min, 72°C, 10min, cycled 35 times, and the PCR product was produced by Shanghai Shenggong Co., Ltd. Sequencing was performed, and the binding was a complete match to SEQ ID NO:1 by sequencing. Subsequently, the target gene amplified by PCR was connected to the empty vector lentiviral vector pHIV-CS-CDF-CG-PRE, and the recombinant lentiviral vector was i...

Embodiment 3

[0078] Example 3 Application of CRISPR / Cas9 in bone marrow mesenchymal stem cells

[0079] CRISPR / Cas9 editing vector based on pBGN plasmid containing BSD-fsEGFP fusion gene

[0080] (1) BSD-fsEGFP fusion gene: use conventional PCR to amplify the known BSD gene, 5'-PCR primers with HindIII sites, and 3'-PCR primers to introduce I-SceI and EcoRI sites. Insert the PCR product (BSD) into the HindIII and EcoRI positions between the CMV driver and the EGFP coding region in the EGFP plasmid (the EGFP nucleotide sequence is a sequence well known in the art, such as shown in sequence 1 and sequence 2 in CN105647968A) Point, generate the plasmid pBGN containing the BSD-fsEGFP fusion gene, the nucleotide sequence of the BSD-fsEGFP fusion gene is as shown in sequence 3 and sequence 4 in CN105647968A). The fusion gene is driven by CMV driver or PGK driver, but EGFP is inactive due to frameshift, so it is called fsEGFP.

[0081] 5'-PCR primers are CTCAAGCTTAACTAAACCATGGCCAAGCCTTTGTCTCAAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides CASP3 gene editing performed on a mesenchymal stem cell through a zsystem, and particularly relates to the establishment of a mesenchymal stem cell line for constructing CASP3 gene knockout. Novel enhancing CREnhancer1.0 is adopted, and CRISPR-cas9 gene editing efficiency in a cell can be obviously improved. Bone mesenchymal stem cell CASP3 gene knocked out plasmid has goodhereditary stability.

Description

technical field [0001] The present invention provides a CRISPR-cas system for performing CASP3 gene editing on mesenchymal stem cells, and in particular relates to the establishment of a CASP3 gene knockout mesenchymal stem cell line. Background technique [0002] Mesenchymal stem cells (MSCs) are adult stem cells with self-replication ability and multi-directional differentiation potential, which can develop into bone, cartilage, fat and other types of cells. Mesenchymal stem cells can be transplanted, and the type of cells they grow into depends on where they are injected. For example, mesenchymal stem cells injected into the heart can form healthy new tissue, among other things. [0003] Mesenchymal stem cells (MSCs) are a type of pluripotent stem cells derived from the mesoderm and ectoderm in early development. Mainly exist in connective tissue and interstitium of organs, and the content is most abundant in bone marrow tissue. Since bone marrow is its main source, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/90C12N15/85
Inventor 杨骏刘语方张立平
Owner 天津金匙医学科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com