Method for knocking out GINS2 gene in mesenchymal stem cells using CRISPR-CAS system

A cell gene and stem cell technology, applied in the field of GINS2 gene editing, can solve problems such as unstable inheritance, and achieve the effect of stable passage and high knockout efficiency

Active Publication Date: 2018-08-24
南京平港生物技术有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to provide a mesenchymal stem cell that knocks out the GINS2 gene, which effectively overcomes the technical defect in the prior art that the use of siRNA for interference cannot stabilize heredity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out GINS2 gene in mesenchymal stem cells using CRISPR-CAS system
  • Method for knocking out GINS2 gene in mesenchymal stem cells using CRISPR-CAS system
  • Method for knocking out GINS2 gene in mesenchymal stem cells using CRISPR-CAS system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Embodiment 1, construction of CRISPR expression vector

[0077] gRNA design

[0078] According to the gene sequence of the target gene, through the applicant's unique optimization design method, the specific form of sgRNA obtained through specific screening is as follows:

[0079] GINS2-sgRNA1:5'to 3'gcgtctcctccgggacgctg

[0080] GINS2-sgRNA2:5'to 3'ccgaggagaccgtgaggctc

[0081] GINS2-sgRNA3:5'to 3'attcctcgccgagaaggagc

[0082] GINS2-sgRNA4:5'to 3'gtcgcctgctccctccagag

[0083] GINS2-sgRNA5:5'to 3'cctgctccctccagagtgga

[0084] GINS2-sgRNA6:5'to 3'gtggatggatgtagaaaagt

[0085] GINS2-sgRNA7:5'to 3'aatgcccagcccttactaca

[0086] GINS2-sgRNA8:5'to 3'tcccgaaggcagacgaaatc

[0087] GINS2-sgRNA9:5'to 3'ggcagacgaaatccggaccc

[0088] GINS2-sgRNA10:5'to 3'tgacagctttgtgagacagc

[0089] GINS2-sgRNA11:5'to 3'cagctttgtgagacagcagg

[0090] GINS2-sgRNA12:5'to 3'gctggataacttgaccttga

[0091] GINS2-sgRNA13:5'to 3'ttgatggagatcaacaccag

[0092] GINS2-sgRNA14:5'to 3'ccgcacgaacctcca...

Embodiment 2

[0108] Example 2 Cloning of enhancer protein CREnhancer1.0 and constructing vector

[0109] The CREnhancer1.0 gene was cloned, and the gene sequence described in SEQ ID NO: 1 was obtained by the method of whole gene synthesis. Using this sequence as a template, according to the sequences of the upstream and downstream primers, they were 5'-ATGCAGGAGAACCTGGCCCCCTG-3', 5 '-CAGGCAGCTCACGCTCCTCTCG-3', primers and whole genome were synthesized by Shanghai Sangong Co., Ltd. The target gene fragment of CREnhancer1.0 gene was amplified by PCR reaction. The amplification reaction system was as follows: 95°C, 40s, 57°C, 1min, 72°C, 1min, 72°C, 10min, cycled 35 times, and the PCR product was produced by Shanghai Shenggong Co., Ltd. Sequencing was performed, and the binding was a complete match to SEQ ID NO:1 by sequencing. Subsequently, the target gene amplified by PCR was connected to the empty vector lentiviral vector pHIV-CS-CDF-CG-PRE, and the recombinant lentiviral vector was ident...

Embodiment 3

[0110] Example 3 Application of CRISPR / Cas9 in bone marrow mesenchymal stem cells

[0111] CRISPR / Cas9 editing vector based on pBGN plasmid containing BSD-fsEGFP fusion gene

[0112] (1) BSD-fsEGFP fusion gene: use conventional PCR to amplify the known BSD gene, 5'-PCR primers with HindIII sites, and 3'-PCR primers to introduce I-SceI and EcoRI sites. Insert the PCR product (BSD) into the HindIII and EcoRI positions between the CMV driver and the EGFP coding region in the EGFP plasmid (the EGFP nucleotide sequence is a sequence known in the art, such as shown in sequence 1 and sequence 2 in CN105647968A) Point, generate the plasmid pBGN containing the BSD-fsEGFP fusion gene, the nucleotide sequence of the BSD-fsEGFP fusion gene is as shown in sequence 3 and sequence 4 in CN105647968A). The fusion gene is driven by CMV driver or PGK driver, but EGFP is inactive due to frameshift, so it is called fsEGFP.

[0113] 5'-PCR primers are

[0114] CTCAAGCTTAACTAAACCATGGCCAAGCCCTTTGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for performing GINS2 gene editing on mesenchymal stem cells by adopting a CRISPR-cas 9 system, and particularly relates to a method for constructing a GINS2 gene-knocked mesenchymal stem cell line. A new enhancin CREnhancer 1.0 is used, so that the editing efficiency of the CRISPR-cas 9 gene in cells can be remarkably improved. The GINS2 knockout plasmid for the mesenchymal stem cells provided by the invention has high genetic stability.

Description

technical field [0001] The present invention provides a GINS2 gene editing method for mesenchymal stem cells using a CRISPR-cas system, and in particular relates to the establishment of a GINS2 gene knockout mesenchymal stem cell line. Background technique [0002] Mesenchymal stem cells (MSCs) are adult stem cells with self-replication ability and multi-directional differentiation potential, which can develop into bone, cartilage, fat and other types of cells. Mesenchymal stem cells can be transplanted, and the type of cells they grow into depends on where they are injected. For example, mesenchymal stem cells injected into the heart can form healthy new tissue, among other things. [0003] Mesenchymal stem cells (MSCs) are a type of pluripotent stem cells derived from the mesoderm and ectoderm in early development. Mainly exist in connective tissue and interstitium of organs, and the content is most abundant in bone marrow tissue. Since bone marrow is its main source, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/90C12N15/85
Inventor杨骏刘语方张立平
Owner南京平港生物技术有限公司