Production of 3-dehydroshikimic acid Escherichia coli recombinant strain and its construction method and application

A kind of technology of dehydroshikimic acid and recombinant strain, applied in the biological field, can solve the problems such as affecting industrial application, genetic instability, and output can not meet market demand, and achieves the effect of reducing production cost and reducing medium cost

Active Publication Date: 2021-02-02
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the Escherichia coli engineering strain constructed in the above research can produce 3-dehydroshikimic acid, its output cannot meet the market demand, and its output needs to be improved
Moreover, the related engineering strains currently constructed either cause genetic instability due to the presence of recombinant plasmids, or need to add organic nitrogen sources or aromatic amino acids and their derivatives to the medium during the production process to promote cell growth, thereby affecting the industry. application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production of 3-dehydroshikimic acid Escherichia coli recombinant strain and its construction method and application
  • Production of 3-dehydroshikimic acid Escherichia coli recombinant strain and its construction method and application
  • Production of 3-dehydroshikimic acid Escherichia coli recombinant strain and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0311] The construction of embodiment 1 escherichia coli recombinant strain WJ004

[0312] With the plasmid pEASY-cat-sacB (such as figure 2 (shown) is a template, and primer 41aroE1-up / aroE1-down is used to amplify the fragment aroE1 of homologous recombination in the first step. The sequence of primer 41 is:

[0313] aroE1-up (forward primer): GATGCCCTGACGGGTGAACTGTTTCGACAGGGGTAACATAGTGACGGAAGATCACTTC

[0314] aroE1-down (reverse primer): CTGTGGGCTATCGGATTACCAAAAACAGCATAGGTTTCCAATCAAAGGGAAAACTGTCC

[0315] Amplification system: 5×TransStart TM FastPfu Buffer 10 μL, dNTPs (2.5 mmol / L each dNTP) 4 μL, DNA template 1 μL (20-50ng), forward primer (10 μmol / L) 2 μL, reverse primer (10 μmol / L) 2 μL, 100% DMSO 1 μL, TransStart TMFastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL.

[0316] The amplification conditions are: 94°C pre-denaturation for 5 minutes (1 cycle); 95°C denaturation for 20 seconds, 55°C annealing for 30 seconds, 72°C extensio...

Embodiment 2

[0335] The construction of embodiment 2 escherichia coli recombinant strain WJ006

[0336] Using Escherichia coli DSM1576 genomic DNA as a template, the aroF gene was amplified using primer 61 aroF-F / aroF-R. The sequence of primer 61 is:

[0337] aroF-F (forward primer): ATGCAAAAAGACGCGCTGAA

[0338] aroF-R (reverse primer): TTAAGCCACGCGAGCCGTCAG

[0339] Amplification system: 5×TransStart TM Taq Buffer 5μL, dNTPs (2.5mmol / L each dNTP) 2μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 1μL, reverse primer (10μmol / L) 1μL, 100% DMSO 1μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL. Amplification conditions were pre-denaturation at 94°C for 5 minutes (1 cycle); denaturation at 95°C for 20 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0340] The amplified aroF gene fragment was cloned into the pEASY-Blunt vector (purchased from Be...

Embodiment 3

[0384] Example 3 Construction of Escherichia coli recombinant strain WJ012

[0385] With the plasmid pEASY-cat-sacB (as shown in SEQ ID NO:7) containing chloramphenicol resistance gene cat and fructan sucrose transferase gene sacB figure 2 (shown) is a template, and primer 121tktA1-up / tktA1-down is used to amplify the fragment tktA1 of homologous recombination in the first step. The sequence of primer 121 is:

[0386] tktA1-up (forward primer): GCCCAAAACGCGCTGTCGTCAAGTCGTTAAGGGCGTGCCCTTCATCATGTGACGGAAGATCACTTC

[0387] tktA1-down (reverse primer): CATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAGGACATATCAAAGGGAAAACTGTCC

[0388] Amplification system: 5×TransStart TM FastPfu Buffer 10 μL, dNTPs (2.5 mmol / L each dNTP) 4 μL, DNA template 1 μL (20-50ng), forward primer (10 μmol / L) 2 μL, reverse primer (10 μmol / L) 2 μL, 100% DMSO 1 μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL. Amplification conditions were pre-denaturation at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an Escherichia coli recombinant strain WJ004 producing 3-dehydroshikimic acid, which reduces 3-dehydrogenase by down-regulating the expression or non-expression of 3-dehydroshikimate dehydrogenase (aroE) Shikimate dehydrogenase enzyme activity. The strain can grow normally in the glucose inorganic salt medium, and can produce 3-dehydroshikimic acid without adding growth factors such as aromatic amino acids and their derivatives, which reduces the cost of the medium, thereby reducing the production of 3-dehydroshikimic acid Cost of production. And the above-mentioned recombinant strains do not contain plasmids and are genetically stable.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the production of 3-dehydroshikimic acid recombinant Escherichia coli and its construction method and application. Background technique [0002] 3-dehydroshikimate (3-dehydroshikimate, DHS) is an important intermediate product in the biosynthetic pathway of aromatic amino acids in microorganisms and plants ( figure 1 ), which plays an important role in maintaining the normal development of organisms and completing metabolic processes (Draths KM, Kambourakis S, Li K, et al. Chemicals and mate-rials from renewable resources. Washington DC: American Chemical Society, 2001: 133-146.). DHS can be further catalyzed to form the precursors of the anti-influenza drug Tamiflu, shikimic acid, protocatechuate, vanillin, catechol, gallate and adipate ) and other important chemical products (Li K, Frost JW.Synthesis of vanillin from glucose.Journal of the American Chemical Society, 1998,120:10545...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/42C12R1/19
Inventor马延和王钦宏陈五九江小龙彭彦峰
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI