Mucosa-targeted immune enhancer for animals and its application in veterinary vaccines

An immune enhancer, a technology for animals, applied in the field of biomedicine, can solve the problems of decreased feed intake, poor vaccine antigen purity, and many miscellaneous proteins.

Active Publication Date: 2020-10-20
JIANGSU ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Second, the inactivated vaccine based on mineral oil has relatively large side effects after immunization of the body
Specifically, for broilers that go out quickly, mineral oil vaccines are difficult to absorb, which will affect meat quality and subsequent consumption
For laying hens, it will affect the decline in egg production of laying hens
For pigs, cattle, etc., after immunization with mineral oil vaccine, it will cause severe side effects such as fever, swelling, and decreased feed intake.
[0005] Third, there is a longer period of antibody production after immunization with inactivated mineral oil-based vaccines
After immunization with mineral oil-based vaccines, the qualified antibodies for effective protection are generally achieved in the third week after immunization, resulting in a state of being unable to provide effective protection against field mutant strains for a long time
This brings a great risk of disease to clinical production
[0006] Fourth, mineral oil-based inactivated vaccines require a higher vaccine antigen content
Veterinary vaccines increase the amount of antigen to improve the efficacy of the vaccine after immunization, but veterinary vaccines are limited by low prices, resulting in poor purity of vaccine antigens, more miscellaneous proteins, and greater side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mucosa-targeted immune enhancer for animals and its application in veterinary vaccines
  • Mucosa-targeted immune enhancer for animals and its application in veterinary vaccines
  • Mucosa-targeted immune enhancer for animals and its application in veterinary vaccines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The preparation of embodiment 1 compound adjuvant and animal vaccine

[0039] (1) Test material

[0040] The CpG was screened by our laboratory, the sequence is TCGTCGTTATAGTCGTTTTAGTCGTT (SEQ NO: 1), and it was synthesized by Nanjing Gensirui, and its skeleton was modified by thiolation during synthesis. α-galactosylceramide (α-galactosylceramide, referred to as α-GC) and Poly (I:C) were purchased from Invivogen. PLGA, PEI and chitosan were purchased from SIGMA Company. Inorganic salts for preparing phosphate buffer were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0041] (2) Test method

[0042] Preparation of compound adjuvants:

[0043] Preparation of compound adjuvant solution: first prepare phosphate (PBS) buffer solution containing 1.44g / L Na 2 HPO 4 , KH of 1.44g / L 2 PO 4 , 8g / L NaCl, 0.2g / L KCl, dissolve the above salts with double distilled water, adjust the pH to 7.0, and sterilize for later use. Add CpG, α-GC, Poly(I:C), PLGA, PEI and chi...

Embodiment 2

[0064] Example 2 Effect of Compound Adjuvant on Immunity of H9 Subtype Avian Influenza Vaccine

[0065] (1) Test material

[0066] H9 subtype avian influenza vaccines L, M and H containing compound adjuvants were prepared according to the method disclosed in Example 1 by using the existing H9 subtype avian influenza vaccine. H9 subtype avian influenza vaccine and H9 subtype avian influenza standard detection antigen were purchased from Nanjing Tianbang Biotechnology Co., Ltd. Specific Pathogen Free (SPF) chickens purchased chicken embryos from Beijing Meria Weitong Experimental Animal Technology Co., Ltd., and were reared in isolators after self-hatching until they were 5-15 days old.

[0067] (2) Test method

[0068] Immunization and grouping: According to the "Compilation of Quality Standards for Veterinary Biological Products (2006-2008)", referred to as "Procedures", chickens within 4 weeks of age are immunized with 0.3mL / chicken, and the immunization route is intramuscu...

Embodiment 3

[0082] Example 3 Effect of compound adjuvant on the safety of H9 subtype avian influenza vaccine in chickens

[0083] (1) Test material

[0084]The H9 subtype avian influenza vaccine H9-MAM containing compound adjuvant was prepared according to the method disclosed in Example 1 by using the existing H9 subtype avian influenza vaccine. H9 subtype avian influenza vaccine and H9 subtype avian influenza standard detection antigen were purchased from Nanjing Tianbang Biotechnology Co., Ltd. Specific Pathogen Free (SPF) chickens purchased chicken embryos from Beijing Meria Weitong Experimental Animal Technology Co., Ltd., and were reared in isolators after self-hatching until they were 5-15 days old.

[0085] (2) Test method

[0086] Immunization and grouping: According to the "Compilation of Quality Standards for Veterinary Biological Products (2006-2008)", referred to as "Procedures", chickens within 4 weeks of age are immunized with 0.3mL / chicken, and the immunization route is ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biological medicine, in particular to a mucosa targeted immunopotentiator for animals and an application of the mucosa targeted immunopotentiator for animals to veterinary vaccines. The invention discloses the mucosa targeted immunopotentiator for animals in order to solve the problems in the prior art at present and meet expectation for ideal veterinary vaccines. The mucosa targeted immunopotentiator for animals contains 0.5 mu g-500 mu g / mL CpG, 0.1 mu g-1mg / mL alpha-GC, 0.1 mu g-3 mg / mL Poly(I:C), 1 mu g-5 mg / mL PLGA, 0.1 mu g-5 mg / mL PEI and 1 mu g-10mg / mL chitosan. Meanwhile, the invention further discloses application probability of the mucosa targeted immunopotentiator for animals to the veterinary vaccines and an application method. Therefore,good mucosal immunity can be produced, immunity window period is shortened, antigen dose is effectively reduced, and sterile immunity is produced.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to an animal mucosa-targeted immune enhancer and its application in veterinary vaccines. Background technique [0002] All kinds of viral infectious diseases restrict the development of aquaculture industry in my country and the world, cause heavy economic losses, and even endanger human public health security. Inactivated vaccines based on mineral oil adjuvants, which are widely used clinically, have played an important role in the prevention and control of these diseases. However, these vaccines still have certain defects, and the quality of vaccines needs to be further improved. These deficiencies include the following: [0003] First, almost no mucosal antibodies were produced after immunization with inactivated mineral oil-based vaccines. However, the main route of viral infection is the mucosal route. Therefore, the mucous membrane is the first line of defense of the host defens...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/39A61P37/04
CPCA61K39/39A61K2039/5252A61K2039/552A61K2039/55511A61K2039/55561A61K2039/55583
Inventor唐应华吴培培陆吉虎张道华张雪花唐波梅梅
OwnerJIANGSU ACAD OF AGRI SCI