Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of a lncrna SGOL1-AS1 as a diagnostic marker for gastric cancer

A gastric cancer and diagnostic kit technology, applied in the application field of lncRNASGOL1-AS1 as a diagnostic marker for gastric cancer, can solve the problem that lncRNA has not been found yet

Active Publication Date: 2021-02-26
CANCER CENT OF GUANGZHOU MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no suitable lncRNA has been found as a cancer marker

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a lncrna SGOL1-AS1 as a diagnostic marker for gastric cancer
  • Application of a lncrna SGOL1-AS1 as a diagnostic marker for gastric cancer
  • Application of a lncrna SGOL1-AS1 as a diagnostic marker for gastric cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037]Example 1 Using RACE technology to obtain the full-length cDNA sequence of SGOL1-AS1

[0038]1. Primer design

[0039]The cDNA sequence of the fragment of lncRNA SGOL1-AS1 is shown in SEQ ID NO: 2, and 5'RACE nested PCR primers and 3'RACE nested PCR primers are designed.

[0040]5’RACE nested PCR first PCR primer, SEQ ID NO.3:

[0041]CCTTCCTGGAGTCCCTGAAAATGT;

[0042]5’RACE nested PCR second PCR primer, SEQ ID NO. 4:

[0043]TTCAGGAGATGATTCCGATGACC

[0044]3’RACE nested PCR first PCR primer, SEQ ID NO.5:

[0045]TCCATTGGTTGGCTGGGAGGCGG;

[0046]3'RACE nested PCR second PCR primer. SEQ ID NO.6:

[0047]ACATTCGCTCAAGTCCACATCCG;

[0048]After experimental verification, nested PCR primers can achieve the expected experimental purpose and specifically amplify the target fragment.

[0049]The total RNA of human SGC-7901 cells was routinely extracted by Trizol method. Then press ClontechRACE 5' / 3' kit (Cat.No.634860) instruction manual for RACE experiment.

[0050]2. The experimental steps are as follows:

[0051](1) cDNA s...

Embodiment 2

[0072]Example 2 A kit for diagnosis of gastric cancer

[0073]1. A kit for gastric cancer diagnosis, including a primer set for gastric cancer detection, positive quality control material and internal reference gene GAPDH primer. The sequence of the primer set used for gastric cancer detection is shown in SEQ ID NO: 7-8; the positive quality control product is a recombinant vector inserted into the cDNA sequence of lncRNA SGOL1-AS1 or a fragment thereof; the internal reference gene GAPDH primer is shown in SEQ ID NO: 9 ~10 shown. The other reagents needed for this kit are all commercially available.

[0074]2. Detection method

[0075](1) Extract sample RNA with Trizol, the specific steps are as follows:

[0076](I) Add an appropriate amount of Trizol to the sample and lyse the sample for 15 minutes at room temperature.

[0077](II) Add 0.2ml of chloroform per ml of Trizol, shake and mix well, and leave it at room temperature for 2-3 minutes.

[0078](III) Centrifuge at 12000g at 4°C for 15min. After...

Embodiment 4

[0109]Example 4 Detection of platelet samples from gastric cancer patients and healthy people

[0110]1. Collect the whole blood of 50 patients with gastric cancer and 45 healthy people. All patients and healthy people are aware of and agree to the test.

[0111]2. Platelet sample

[0112]5mL of fresh blood was collected on an empty stomach, stored in an EDTA anticoagulation tube, and kept at room temperature for no more than 1 hour. Centrifuge at 150g for 10min at room temperature, aspirate the upper layer of platelet-rich plasma, then centrifuge at 400g for 20min at room temperature, aspirate the supernatant, and precipitate platelets, add 30μl RNAlater to the platelets, overnight at 4°C, transfer to -80°C for long-term storage.

[0113]3. Detect the above samples according to the method described in Example 2.

[0114]4. Results: The expression of lncRNASGOL1-AS1 in platelets of patients with gastric cancer was significantly lower than that of healthy people (Figure 5).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of lncRNA SGOL1-AS1 as a diagnostic marker for gastric cancer. An lncRNA SGOL1‑AS1, the cDNA sequence of which is shown in SEQ ID NO:1. The present invention finds the application of lncRNA SGOL1‑AS1 or its fragments as a diagnostic marker for gastric cancer. The gastric cancer diagnostic kit constructed by the present invention includes a pair of specific detection primers, which can detect tissue samples, or blood samples such as plasma, serum, and platelets. The non-invasive diagnosis method for blood samples has more clinical application value, and can achieve good detection results in the early stage of gastric cancer, which has high promotion value.

Description

Technical field[0001]The present invention relates to the technical field of gastric cancer diagnosis, and more specifically, to the application of an lncRNA SGOL1-AS1 as a gastric cancer diagnostic marker.Background technique[0002]Gastric cancer is one of the highest incidence of malignant tumors in the world. It ranks fourth in incidence and second in mortality among all malignant tumors. There are up to 1 million new cases of gastric cancer worldwide each year, and about 700,000 patients die. The 5-year survival rate is less than 20%, and the 5-year survival rate after treatment for early gastric cancer can reach more than 90%. Therefore, early diagnosis is very important to improve the efficacy of gastric cancer. At present, the most valuable method for gastric cancer diagnosis is gastroscopy. However, gastroscopy is an invasive examination and is not suitable as a routine screening examination. At present, the clinical markers of gastric cancer mainly include CEA, CA19-9, CA-12...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/113
CPCC12Q1/6886C12Q2600/158C12Q2600/178
Inventor 邓敏杨文娟刑珊宋莹
Owner CANCER CENT OF GUANGZHOU MEDICAL UNIV