Application of a lncrna SGOL1-AS1 as a diagnostic marker for gastric cancer
A gastric cancer and diagnostic kit technology, applied in the application field of lncRNASGOL1-AS1 as a diagnostic marker for gastric cancer, can solve the problem that lncRNA has not been found yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037]Example 1 Using RACE technology to obtain the full-length cDNA sequence of SGOL1-AS1
[0038]1. Primer design
[0039]The cDNA sequence of the fragment of lncRNA SGOL1-AS1 is shown in SEQ ID NO: 2, and 5'RACE nested PCR primers and 3'RACE nested PCR primers are designed.
[0040]5’RACE nested PCR first PCR primer, SEQ ID NO.3:
[0041]CCTTCCTGGAGTCCCTGAAAATGT;
[0042]5’RACE nested PCR second PCR primer, SEQ ID NO. 4:
[0043]TTCAGGAGATGATTCCGATGACC
[0044]3’RACE nested PCR first PCR primer, SEQ ID NO.5:
[0045]TCCATTGGTTGGCTGGGAGGCGG;
[0046]3'RACE nested PCR second PCR primer. SEQ ID NO.6:
[0047]ACATTCGCTCAAGTCCACATCCG;
[0048]After experimental verification, nested PCR primers can achieve the expected experimental purpose and specifically amplify the target fragment.
[0049]The total RNA of human SGC-7901 cells was routinely extracted by Trizol method. Then press ClontechRACE 5' / 3' kit (Cat.No.634860) instruction manual for RACE experiment.
[0050]2. The experimental steps are as follows:
[0051](1) cDNA s...
Embodiment 2
[0072]Example 2 A kit for diagnosis of gastric cancer
[0073]1. A kit for gastric cancer diagnosis, including a primer set for gastric cancer detection, positive quality control material and internal reference gene GAPDH primer. The sequence of the primer set used for gastric cancer detection is shown in SEQ ID NO: 7-8; the positive quality control product is a recombinant vector inserted into the cDNA sequence of lncRNA SGOL1-AS1 or a fragment thereof; the internal reference gene GAPDH primer is shown in SEQ ID NO: 9 ~10 shown. The other reagents needed for this kit are all commercially available.
[0074]2. Detection method
[0075](1) Extract sample RNA with Trizol, the specific steps are as follows:
[0076](I) Add an appropriate amount of Trizol to the sample and lyse the sample for 15 minutes at room temperature.
[0077](II) Add 0.2ml of chloroform per ml of Trizol, shake and mix well, and leave it at room temperature for 2-3 minutes.
[0078](III) Centrifuge at 12000g at 4°C for 15min. After...
Embodiment 4
[0109]Example 4 Detection of platelet samples from gastric cancer patients and healthy people
[0110]1. Collect the whole blood of 50 patients with gastric cancer and 45 healthy people. All patients and healthy people are aware of and agree to the test.
[0111]2. Platelet sample
[0112]5mL of fresh blood was collected on an empty stomach, stored in an EDTA anticoagulation tube, and kept at room temperature for no more than 1 hour. Centrifuge at 150g for 10min at room temperature, aspirate the upper layer of platelet-rich plasma, then centrifuge at 400g for 20min at room temperature, aspirate the supernatant, and precipitate platelets, add 30μl RNAlater to the platelets, overnight at 4°C, transfer to -80°C for long-term storage.
[0113]3. Detect the above samples according to the method described in Example 2.
[0114]4. Results: The expression of lncRNASGOL1-AS1 in platelets of patients with gastric cancer was significantly lower than that of healthy people (Figure 5).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


