General molecular markers, primers, detection methods and applications for detection of wheat powdery mildew resistance pm57 gene
A technology for wheat powdery mildew and molecular markers, applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve the problem of not being universal and not able to simultaneously detect wheat-Sears goatgrass Chromosomes, genotypes and other problems, to achieve the effect of reducing work complexity, good application prospects, and high detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0037] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments, but should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.
[0038] The present invention provides a universal molecular marker for detecting the resistance to wheat powdery mildew Pm57 gene, the universal molecular marker is molecular marker X185442, and the nucleotide sequence is as shown in SEQ ID NO.1, which is:
[0039] AGAGGTGTTCGATGTGGAGCTCGTAGGACGGGAGCAGAAGGATGGCGAAGAGAGCATGGTGATATTCTGCAGCTCGCCGTAGACTGTTGCAGTCAAGA Among them, the italicized and underlined part of the front part is the binding position of the upstream primer 185442F, and the italiciz...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



