Unlock instant, AI-driven research and patent intelligence for your innovation.

General molecular markers, primers, detection methods and applications for detection of wheat powdery mildew resistance pm57 gene

A technology for wheat powdery mildew and molecular markers, applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve the problem of not being universal and not able to simultaneously detect wheat-Sears goatgrass Chromosomes, genotypes and other problems, to achieve the effect of reducing work complexity, good application prospects, and high detection efficiency

Active Publication Date: 2021-01-26
HENAN AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, due to the different genotypes of each wheat variety, there is no simultaneous detection of wheat-Sears goatgrass chromosome 2S S #1 Report on the universal molecular markers of the Pm57 gene contained in the addition line 2011-400 and the translocation lines 89(6)88, 89(5)69, and 89-346
Although there is a molecular marker X2L4g9p4 / HaeIII linked to the Pm57 gene in the prior art, the full-length cDNA (AK331687) of the developed X2L4g9p4 / HaeIII marker is located between FL0.86-0.91 of the long arm of the second homology group of wheat. Molecular markers cannot detect the Pm57 gene carried by 89(6)88 disease-resistant materials, which is not universal and has limited application in molecular marker-assisted selection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • General molecular markers, primers, detection methods and applications for detection of wheat powdery mildew resistance pm57 gene
  • General molecular markers, primers, detection methods and applications for detection of wheat powdery mildew resistance pm57 gene
  • General molecular markers, primers, detection methods and applications for detection of wheat powdery mildew resistance pm57 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments, but should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0038] The present invention provides a universal molecular marker for detecting the resistance to wheat powdery mildew Pm57 gene, the universal molecular marker is molecular marker X185442, and the nucleotide sequence is as shown in SEQ ID NO.1, which is:

[0039] AGAGGTGTTCGATGTGGAGCTCGTAGGACGGGAGCAGAAGGATGGCGAAGAGAGCATGGTGATATTCTGCAGCTCGCCGTAGACTGTTGCAGTCAAGA Among them, the italicized and underlined part of the front part is the binding position of the upstream primer 185442F, and the italiciz...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of wheat gene detection, and in particular relates to a general molecular marker, primer, detection method and application for detection of wheat powdery mildew resistance Pm57 gene. The universal molecular marker is molecular marker X185442, and the nucleotide sequence is shown in SEQ ID NO.1. The sequences of the primers are: upstream primer 185442F: 5'-GCACGGTGGGTGTGTTCC-3' and downstream primer 185442R: 5'-CTCACTATGATGTGTGAGGTTCTT-3'. Molecular marker X185442 provided by the present invention can simultaneously detect wheat-Sears goat grass chromosome 2S S #1 Addition line 2011‑400 and translocation lines 89(6)88, 89(5)69, 89‑346 contain the Pm57 gene, which has high versatility and detection efficiency, and reduces the complexity of work. At the same time, we optimized the PCR amplification system of the molecular marker X185442, and obtained an efficient PCR system and detection method matching the molecular marker X185442.

Description

technical field [0001] The invention belongs to the technical field of wheat gene detection, and in particular relates to a general molecular marker, primer, detection method and application for detection of wheat powdery mildew resistance Pm57 gene. Background technique [0002] The Pm57 gene was obtained from Aegilops searsii, 2n=2x=14, S S S S ) is transferred to a new powdery mildew resistance gene of common wheat, which can effectively prevent the occurrence of wheat powdery mildew, and has broad application prospects in the field of wheat breeding. Therefore, it is of great biological significance to study the function and application of Pm57 gene. The Pm57 gene is located in the 2S of Sears goatgrass S Proximal part of the long arm of chromosome #1, wheat-Sears goatgrass chromosome 2S S 2S in #1 addition line 2011-400 and translocation lines 89(6)88, 89(5)69, 89-346 S The fragments all contain the powdery mildew resistance Pm57 gene. [0003] However, due to the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 刘文轩董振杰夏晴麦艳娜马超李欢欢
Owner HENAN AGRICULTURAL UNIVERSITY