Unlock instant, AI-driven research and patent intelligence for your innovation.

A primer smemboi-1 for the purity identification of Zilong No. 3 eggplant based on SNP markers and its application

A technology of smemboi-1-r and smemboi-1-f, which is applied to the primer SmemboI-1 and its application field for the identification of the purity of Zilong No. Strong application value and stable operation effect

Active Publication Date: 2021-06-11
WUHAN ACADEMY OF AGRI SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there have been no reports of using SNP markers to identify the purity of eggplant hybrids, and the present invention belongs to the first use of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer smemboi-1 for the purity identification of Zilong No. 3 eggplant based on SNP markers and its application
  • A primer smemboi-1 for the purity identification of Zilong No. 3 eggplant based on SNP markers and its application
  • A primer smemboi-1 for the purity identification of Zilong No. 3 eggplant based on SNP markers and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Acquisition of SNP molecular marker primers identified by the seed purity test of eggplant 'Zilong No.3':

[0033] Download the eggplant EST sequence from the NCBI public database (https: / / www.ncbi.nlm.nih.gov / ), and use the Samtools tool (http: / / samtools.sourceforge.net) to align the above EST sequence to the eggplant genome ( http: / / eggplant.kazusa.or.jp / ) sequence and SNP site query, using the SNPsCAPs program for enzyme site conversion and CAPS primer design, the selected primers were screened by PCR and enzyme polymorphism, and finally obtained Two pairs of primers for polymorphisms, ie, SmemboI-1 and SmemboI-2, and the detection restriction enzyme of the two pairs of primers are both MboI.

[0034]After primer SmemboI-1 PCR amplification and enzyme digestion, two specific bands of 160bp and 95bp were produced in the female parent of 'Zilong No. 3', and a specificity band of 255bp was produced in the male parent of 'Zilong No. 3' bring.

[0035] A specific band o...

Embodiment 2

[0047] Utilize primer SmemboI-1 and / or SmemboI-2 to the method for eggplant 'Zilong No. 3' eggplant purity identification, the steps comprise:

[0048] (1) DNA extraction of eggplant to be tested: the genomic DNA of eggplant cotyledon was extracted by CTAB method, the cotyledon was ground with liquid nitrogen or crushed with steel balls, lysed with 2×CTAB lysate, extracted with chloroform, precipitated with isopropanol and washed with 70% ethanol, etc. process, the final DNA pellet was dissolved in 20 μL TE solution.

[0049] (2) PCR amplification: Use primer SmemboI-1 or primer SmemboI-2 to carry out PCR amplification on the genomic DNA of 'Zilong No. 3' and its parents. The PCR reaction system is: 6 μL 2×Taq PCR Master Mix, 4 μL ddH2O2 Bacterial water, 0.5 μL forward primer (2.5 nM concentration), 0.5 μL reverse primer (2.5 nM concentration), and 1 μL eggplant gene DNA extracted above;

[0050] Primer SmemboI-1:

[0051] SmemboI-1-F: 5'-CAATGAGAGGACGATTAATGACA-3';

[0052...

Embodiment 3

[0063] Application of primers SmemboI-1 and / or SmemboI-2 in eggplant purity identification of eggplant 'Zilong No. 3':

[0064] Sample to be tested:

[0065] A mixed sample of 5 individual plants of the male parent of 'Zilong 3' and a mixed sample of 5 individual plants of the female parent of 'Zilong 3'; 120 individual plants of 'Zilong Hao' and its parents were planted in the experimental greenhouse when they had 4-5 true leaves, and numbered sequentially (the experimental number was the same as the field number), and the agronomic traits of each individual plant were observed at the commercial fruiting stage.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of agricultural vegetable breeding and molecular detection, and discloses a primer SmemboI‑1 for the purity identification of Zilong No. 3 eggplant based on SNP markers and its application. The primer is: SmemboI‑1‑F: 5' ‑CAATGAGAGGACGATTAATGACA‑3′ and SmemboI‑1‑R: 5′‑GGAAGACAAGAATAATAGTGTACATGC‑3′. The primer can effectively distinguish 'Zilong No. 3' and its female parent and male parent; the present invention also discloses another pair of primers SmemboI-2, which can be combined with primer SmemboI-1 to identify 'Zilong III' No.' and its female parent and male parent were identified. The primer and the primer combination provided by the invention have the advantages of rapidity, accuracy, stability, easy operation, etc., can replace the traditional method for field purity identification of eggplant hybrids, and have strong application value.

Description

technical field [0001] The invention belongs to the technical field of agricultural vegetable breeding and molecular detection, and specifically relates to a primer SmemboI-1 for identifying the purity of Zilong No. 3 eggplant based on SNP markers and its application. Background technique [0002] Seed purity is one of the most important links in seed quality testing. The test of new plant variety specificity (Distinctness), consistency (Uniformity) and stability (Stability) (DSU test for short) is an application for the new plant variety protection office of the Ministry of Agriculture. The most important work content is the substantive examination for granting new variety rights. The traditional identification method of seed purity is based on the observation of the field morphology of the plant after sowing, and observes the agronomic traits of the first generation of hybrids to judge whether it is a pseudo-hybrid. Influenced by factors, it is easy to cause errors in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 张洪源谈杰陈霞黄树苹张敏谈太明
Owner WUHAN ACADEMY OF AGRI SCI