Supercharge Your Innovation With Domain-Expert AI Agents!

Method for preparing next generation sequencing connector with plurality of molecular tags

A technology for molecular tags and sequencing adapters, which is applied in the field of molecular biology and can solve the problems of lack of a better method for adding double-stranded tags.

Inactive Publication Date: 2019-02-22
YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, there is currently no better method for adding double-stranded tags to facilitate library construction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing next generation sequencing connector with plurality of molecular tags
  • Method for preparing next generation sequencing connector with plurality of molecular tags
  • Method for preparing next generation sequencing connector with plurality of molecular tags

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] Specific embodiments of the present invention will be described below.

[0033] Step 1: Synthesize the linker sequence. Synthesize the following two sequences:

[0034] Sequence 1:

[0035] 5-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCC GAT*C*T

[0036] Sequence 2:

[0037] 5-NNNN-ANNNNNNGGATAC-AG*A*TCGGAAGAGC-ACACGTCTGAACTCCAGTCA C-NNNN-NNNNNNNN-ATCTCGTATGCCGTCTTCTGCT*T*G

[0038] "*" in the sequence is a protective modification;

[0039] The 1st to 4th bases are the protection bases of restriction endonucleases, which are set to four in this embodiment, and in other embodiments, the number of bases can be 0-10. The specific bases are variable, depending on the actual case design;

[0040] The 6th to 10th bases are double-stranded molecular tags with 5 random bases;

[0041] The 51st to 54th bases are single-strand molecular tags with 4 random bases, and the number of bases can be changed according to the application;

[0042] The bases from the 55t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing a next generation sequencing connector with a plurality of molecular tags. The method is characterized by comprising the following steps: step 1: synthesizing a connector sequence, wherein the connector sequence comprises a first sequence and a second sequence, the second sequence comprises a protection basic group of a restriction enzyme and double-chain molecular tags of 5 random basic groups, and a variable basic group in an enzyme digestion site, and the first sequence and the second sequence have complementary sequence fragments; step 2: annealing the connector sequence and uniformly mixing the first sequence and the second sequence; annealing in an annealing system according to an annealing program to form double chains; step 3: supplementing the connector of the double chains formed in step 2; and step 4; carrying out enzyme digestion and recycling the connector. The connector contains longer double-chain molecular tags and providesa better information foundation for biological information analysis; the connector can be obtained through efficient and relatively economical and practical synthesis; and the connector is applicableto various sequencing platforms.

Description

technical field [0001] The invention relates to a method for preparing a next-generation sequencing adapter with multiple molecular tags, belonging to the field of molecular biology. Background technique [0002] In the Illumina sequencing platform, adapters are a necessary element in next-generation sequencing library construction. Currently, official adapters include various types, and the sequences include p5 and p7 amplification primer binding sequences, read1 and read2 sequencing primer binding sequences, and sample labels. sequence, molecular tag sequence, etc., and has a 3'-dT tail for A / T ligation. [0003] At present, single-strand molecular tags are usually designed at the p7 end to add tags to target molecules in the library, so that the bioinformatics analysis process can capture more refined molecular information and reduce the background noise of variation analysis. [0004] In addition, double-strand molecular tags can also be combined with single-strand mole...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6811
CPCC12Q1/6811C12Q2521/301C12Q2525/191
Inventor 郑贤杰朱垚曹振袁慧艳宋东亮
Owner YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com