A strain of Lactobacillus paracasei and its application

A technology for lactobacillus and paracheese, which is applied in the field of microorganisms and microbial fermentation, can solve the problems of low 2,3-butanedione content, etc., and achieve the effects of enhancing milk flavor and improving market competitiveness.

Active Publication Date: 2020-06-09
JIANGNAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] It is currently known that the main substances affecting the flavor of sour cream are 2,3-butanedione, acetic acid and butyric acid, among which 2,3-butanedione is the main contributor to the milk flavor; and 32 The content of 2,3-butanedione in three kinds of commercially available sour cream, the measured results show that the general content of 2,3-butanedione is between 0.45 and 130 μg / kg, of which, only three kinds of commercially available sour cream The content of 2,3-butanedione is relatively high, respectively 164μg / kg, 172μg / kg, and 261μg / kg. Therefore, the content of 2,3-butanedione in the existing commercially available sour cream is generally low, and the content of 2,3-butanedione is high There are still vacancies in the market for milk flavored yoghurt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A strain of Lactobacillus paracasei and its application
  • A strain of Lactobacillus paracasei and its application
  • A strain of Lactobacillus paracasei and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1: the screening of bacterial strain of the present invention

[0067] (1) Obtain a suitable dilution gradient and culture

[0068] Weigh 0.5mL from the traditional fermented koji sample in Aba Autonomous Prefecture, Sichuan, add it to 4.5mL sterile water, and then take 0.5mL bacterial solution and dilute it in 4.5mL sterile water, so that the concentration of the sample is diluted to 10 -4 50 μL of each of the four bacterial suspensions with a dilution of 10 to 104 were spread on the MRS solid medium, and cultured at 37° C. for 46 to 48 hours.

[0069] (2) Separation and purification

[0070] A typical single colony was selected by the plate streaking method, and strains with excellent traits were obtained after repeating the cultivation and selection operation. This operation obtained three strains in total, namely strain CGMCC No.14023, strain 15M9 and strain 5G2.

[0071] (3) Gram staining and catalase test

[0072] Pick single colonies of the above st...

Embodiment 2

[0073] Embodiment 2: the identification of bacterial strain of the present invention

[0074] (1) PCR amplification of 16S rDNA

[0075] Take out the liquid culture medium after shaking and mixing in a 1mL glycerol tube, centrifuge and discard the supernatant, wash with 1mL sterile water for 2 times, centrifuge and discard the supernatant, and use it as a template for colony PCR.

[0076] a) 50 μL of PCR system, including 25 μL of Mix, 1 μL of 27F, 1 μL of 1492R, and 23 μL of ddH2O.

[0077] The primers used were 27F as shown in SEQ ID NO.2: AGAGTTTGATCCTGGCCTCA and 1492R as shown in SEQ ID NO.3: GGTTACCTTGTTACGACTT, and the length of the amplified fragment was 1500 bp.

[0078] b) PCR conditions:

[0079] Lid: 105°C mBY-16s V: 20 μL

[0080] DNA double strands were denatured at 94°C for 10min, cooled at 50°C for 30s at 94°C for 30s, rapidly raised to 72°C for 80s, and cycled 29 times, and finally kept at 72°C for 7min.

[0081] (2) Agar gel electrophoresis (80mL)

[0082...

Embodiment 3

[0086] Embodiment 3: the application of bacterial strain of the present invention

[0087] Inoculate Lactobacillus paracasei 15M9, Lactobacillus paracasei 5G2 and Lactobacillus paracasei CGMCCNo.14023 stored at -80°C in MRS liquid medium respectively, culture them at 37°C for 24 hours, subculture 2 to 3 times, and take bacteria 80 μL of the solution was inoculated in a headspace phase bottle (containing 2 mL of 20% fat cream), and placed at 20°C for 24 hours for fermentation. During this period, samples were taken every 6 hours, and the fermentation samples were tested for 2,3-butanedione. Content, sensory evaluation, pH and titratable acidity detection (the content detection results of 2,3-butanedione are shown in Table 1, and the pH detection results are shown in Table 2, figure 1 , titratable acidity detection results are shown in Table 3, figure 2 , see sensory evaluation results image 3 ).

[0088] As can be seen from Table 1, the 2,3-butanedione output produced by L...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain of Lactobacillus paracasei and application thereof, belonging to the technical field of microorganisms and microbial fermentation. The present invention isolates and screens out a strain of Lactobacillus paracasei (Lactobacillus paracasei) from yak milk products. This Lactobacillus paracasei (Lactobacillus paracasei) has a strong ability to produce 2,3-butanedione. After 24 hours of fermentation, 2,3- The yield of diacetyl can be as high as 759 μg / kg; applying this Lactobacillus paracasei to the preparation of sour cream can significantly enhance the milk flavor of sour cream and improve the market competitiveness of sour cream.

Description

technical field [0001] The invention relates to a strain of Lactobacillus paracasei and an application thereof, belonging to the technical field of microorganisms and microbial fermentation. Background technique [0002] Sour cream refers to a kind of dairy product made from cream, which is fermented by pure lactic acid bacteria starter and further processed. It has a bright surface, uniform texture, unique sour flavor, and rich nutrition. It can be eaten directly. It is also an ideal ingredient for western food, and has a broad market among consumers of all ages. [0003] Studies have shown that the main factors affecting consumers to buy sour cream are flavor, price, usability and brand in turn, while Shepard et al. (L.shepard, R.E.miracle, et al. ].Journal of dairy science, 2013,96(9):5435-5454.) found through research that the milk flavor in sour cream is preferred by consumers. [0004] It is currently known that the main substances affecting the flavor of sour cream ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/20A23C13/16A61K35/747A61P1/00C12R1/225
CPCA61P1/00A23C13/16A61K2035/115C12R2001/225C12N1/205A23V2400/165
Inventor陈卫刘小鸣姜杨王岩范大明赵建新张灏
OwnerJIANGNAN UNIV